INFORMAZIONI SU QUESTO ARTICOLO

Cita

Figure 1

Exposure setup
Exposure setup

Figure 2

Changes in body weight by study groups; each point represents mean ± SE (n=6). The asterisk (*) marks significant difference in body weight between day 0 and pre-exposure measurement in the toluene and combined groups (P<0.05)
Changes in body weight by study groups; each point represents mean ± SE (n=6). The asterisk (*) marks significant difference in body weight between day 0 and pre-exposure measurement in the toluene and combined groups (P<0.05)

Figure 3

Mean (±SD) relative tissue weights (tissue/body weight) by study groups (n=6) and organs: heart (A), lung (B), spleen (C), and stomach (D)
Mean (±SD) relative tissue weights (tissue/body weight) by study groups (n=6) and organs: heart (A), lung (B), spleen (C), and stomach (D)

Figure 4

Changes in IL-β (A) and TNF-α (B) levels by study groups; each point represents mean ± SE (n=6). a – significantly higher in the combined than the noise group (P<0.05); b – significantly lower in the combined than control group (P<0.05)
Changes in IL-β (A) and TNF-α (B) levels by study groups; each point represents mean ± SE (n=6). a – significantly higher in the combined than the noise group (P<0.05); b – significantly lower in the combined than control group (P<0.05)

Figure 5

Changes in the expression of Bax (A), Bcl-2 (B), and the Bax/Bcl-2 ratio (C) in heart, lung, spleen, and stomach tissues by study groups. Each bar represents maen±SE values (n=6). Asterisks represent significant differences compared to control (* P<0.05, ** P<0.001). The circle symbol (●) represents a significant difference between the noise and combined groups (P<0.05)
Changes in the expression of Bax (A), Bcl-2 (B), and the Bax/Bcl-2 ratio (C) in heart, lung, spleen, and stomach tissues by study groups. Each bar represents maen±SE values (n=6). Asterisks represent significant differences compared to control (* P<0.05, ** P<0.001). The circle symbol (●) represents a significant difference between the noise and combined groups (P<0.05)

Figure 6

Representative appearances of the heart tissue stained with H&E. The photographs were taken at 10× (B2 and D) and 40× (A, B1, and C) magnification. The control group (A) had a normal structure, however, congestion (thick blue arrow) and vessel dilation (thick black arrow with blue outline) appeared in the noise exposure group (B1 and B2). Additionally, myocardial local degenerative changes (thick black arrow head with blue outline) and lymphocyte infiltration (narrow black arrow) observed in the toluene exposure group (C). Furthermore, congestion (thick blue arrow) was visible in the simultaneous exposure group (D)
Representative appearances of the heart tissue stained with H&E. The photographs were taken at 10× (B2 and D) and 40× (A, B1, and C) magnification. The control group (A) had a normal structure, however, congestion (thick blue arrow) and vessel dilation (thick black arrow with blue outline) appeared in the noise exposure group (B1 and B2). Additionally, myocardial local degenerative changes (thick black arrow head with blue outline) and lymphocyte infiltration (narrow black arrow) observed in the toluene exposure group (C). Furthermore, congestion (thick blue arrow) was visible in the simultaneous exposure group (D)

Figure 7

Representative appearances of the lung tissue stained with H&E. The photographs were taken at 10× (A, B, C, and D) and 40× (a, b, c, and d) magnification. The control group (A and a) had a normal structure. Nevertheless, mild alveolar dilation appeared in noise, toluene, and simultaneous exposure groups. Moreover, imperceptible emphysema appeared in the toluene exposure group. Symbols denote parenchymal hemorrhage (narrow black arrow), inter-alveolar septal thickening (thick black arrow with green outline), and lymphocyte infiltration (thick blue arrow with yellow outline)
Representative appearances of the lung tissue stained with H&E. The photographs were taken at 10× (A, B, C, and D) and 40× (a, b, c, and d) magnification. The control group (A and a) had a normal structure. Nevertheless, mild alveolar dilation appeared in noise, toluene, and simultaneous exposure groups. Moreover, imperceptible emphysema appeared in the toluene exposure group. Symbols denote parenchymal hemorrhage (narrow black arrow), inter-alveolar septal thickening (thick black arrow with green outline), and lymphocyte infiltration (thick blue arrow with yellow outline)

Figure 8

Representative appearances of the stomach tissue stained with H&E. The photographs were taken at 10× (A, B, C, and D) and 40× (a, b, c, and d) magnification. The control group appeared in normal condition (A and a). The noise exposure group (B and b) observed with cellular swelling. The toluene exposure group (C and c) and the simultaneous exposure group (D and d) appeared more destructed than the noise exposure group. Symbols denote glycocalix layer (narrow black arrow), epithelium exfoliation (thick black arrow head with yellow outline), congestion (thick blue arrow), pyknotic cells (thick black arrow with yellow outline), and glandular cell disorganisation (thick white arrow with black outline)
Representative appearances of the stomach tissue stained with H&E. The photographs were taken at 10× (A, B, C, and D) and 40× (a, b, c, and d) magnification. The control group appeared in normal condition (A and a). The noise exposure group (B and b) observed with cellular swelling. The toluene exposure group (C and c) and the simultaneous exposure group (D and d) appeared more destructed than the noise exposure group. Symbols denote glycocalix layer (narrow black arrow), epithelium exfoliation (thick black arrow head with yellow outline), congestion (thick blue arrow), pyknotic cells (thick black arrow with yellow outline), and glandular cell disorganisation (thick white arrow with black outline)

Figure 9

Representative appearances of the spleen tissue stained with H&E. The photographs were taken at 10× (A, B, C, and D) and 40× (a, b, c, and d) magnification. The control group (A and a) presented with normal tissue. The noise group (B and b), the toluene group (C and c), and the combined group (D and d) showed some pathological changes in lymphoid tissue. The noise group showed larger lymphoid tissue, yet smaller than the toluene group. It had more dilated and bloodier sinusoids than control and the toluene group. The combined group showed the same as its components but the changes were more prominent
Representative appearances of the spleen tissue stained with H&E. The photographs were taken at 10× (A, B, C, and D) and 40× (a, b, c, and d) magnification. The control group (A and a) presented with normal tissue. The noise group (B and b), the toluene group (C and c), and the combined group (D and d) showed some pathological changes in lymphoid tissue. The noise group showed larger lymphoid tissue, yet smaller than the toluene group. It had more dilated and bloodier sinusoids than control and the toluene group. The combined group showed the same as its components but the changes were more prominent

Coefficients of ANOVA analysis for different apoptosis indices in the heart, lung, spleen, and stomach on day 14 post exposure (values are modified based on pre-exposure and control values to remove the effects of confounding variables)

Tissue Parameter Noise group Toluene group Combined group
Heart Bax 4.58±1.34 -0.88±1.34 1.44±1.34
Bcl-2 3.08±1.01 -0.39±1.01 1.62±1.01
Bax/Bcl-2 0.0217±0.0882 -0.0138±0.0882 -0.0233±0.0882
Lung Bax 3.39±1.46 0.54±1.46 4.19±1.46
Bcl-2 -3.71±1.06 -2.55±1.06 -0.00±1.06
Bax/Bcl-2 0.430±0.125 0.165±0.125 0.102±0.125
Spleen Bax -0.08±1.24 0.70±1.24 5.35±1.24
Bcl-2 2.33±1.21 -1.61±1.21 -3.10±1.21
Bax/Bcl-2 -0.192±0.131 0.131±0.131 0.617±0.131
Stomach Bax 1.34±1.34 0.45±1.34 2.60±1.34
Bcl-2 -0.08±1.39 -0.35±1.39 0.46±1.39
Bax/Bcl-2 0.0598±0.0884 0.0578±0.0884 0.0738±0.0884

Primers used for quantitative RT-PCR analyses

Gene Primer sequence (5'-3') length (bp)
Bax Forward: AGGTCTTTTTCCGAGTGGCAGC 234
Revers: GCGTCCCAAAGTAGGAGAGGAG

Bcl-2 Forward: GACGACTTCTCCCGCCGCTAC 245
Revers: CGGTTCAGGTACTCAGTCATCCAC

GAPDH Forward: GCCAAAAGGGTCATCATCTCTGC 183
Revers: GGTCACGAGTCCTTCCACGATAC

Coefficients of ANOVA analysis for relative tissue weights (tissue/body weight) in different groups taken on day 14 post exposure [(values are modified based on pre-exposure and control values to remove the effects of confounding variables. Combined effects (synergism, antagonism) were calculated as described in a study by Piggott et al. (30).]

Tissue Noise group Toluene group Combined group Interaction type
Heart 0.075±0.279 -0.146±0.279 0.222±0.279 +Synergism
Lung -0.416±0.506 0.488±0.506 0.120±0.506 -Antagonism
Spleen -0.264±0.116 0.121±0.116 0.203±0.116 +Synergism
Stomach -1.611±0.891 0.056±0.891 0.850±0.891 +Synergism

GEE analysis for body weights and the immunological parameters in respect to control over the 14 days after the end of exposure to noise and/ or toluene in New Zealand rabbits [(values are modified based on pre-exposure and control values to remove the effects of confounding variables. Combined effects (synergism, antagonism) were calculated as described in a study by Piggott et al. (30)]

Time point post exposure Parameter Noise group Toluene group Combined group Interaction type
Day 0 TNF-α 3.927±2.636 6.477±3.862 0.560±2.439 +Antagonism
IL-β -0.535±1.412 2.490b±0.689 0.900±1.462 +Antagonism
Body weight 0.028±0.091 -0.075±0.090 -0.081a±0.036 -Synergism
Day 3 TNF-α 6.895±9.150 3.320±4.591 -2.800±6.901 -Synergism
IL-β 0.600±1.215 0.350±0.930 2.140±1.242 +Synergism
Body weight 0.018±0.076 -0.097a±0.038 0.011±0.020 -Antagonism
Day 7 TNF-α 3.981±10.624 7.406±5.010 -2.180±5.128 -Synergism
IL-β -0.703±0.687 0.447±2.221 1.540±0.917 +Synergism
Body weight 0.038±0.059 -0.06±0.036 0.031±0.020 -Antagonism
Day 14 TNF-α 1.525±7.446 -0.975±7.747 -1.420±2.416 -Synergism
IL-β 0.821±0.809 -0.004±0.811 1.220±0.973 +Synergism
Body weight 0.116±0.096 -0.003±0.043 0.121b±0.027 +Synergism
eISSN:
1848-6312
Lingue:
Inglese, Slovenian
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Medicine, Basic Medical Science, other