Accesso libero

Analysis of TGFB1, CD105 and FSP1 expression in human granulosa cells during a 7-day primary in vitro culture

Artur Bryja

Artur Bryja

Department of Anatomy, Poznań University of Medical SciencePoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Bryja, Artur
, 
Wojciech Pieńkowski

Wojciech Pieńkowski

Division of Perinatology and Women’s Diseases, Poznań University of Medical SciencesPoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Pieńkowski, Wojciech
, 
Katarzyna Stefańska

Katarzyna Stefańska

Department of Histology and Embryology, Poznań University of Medical SciencePoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Stefańska, Katarzyna
, 
Błażej Chermuła

Błażej Chermuła

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Chermuła, Błażej
, 
Rut Bryl

Rut Bryl

Department of Anatomy, Poznań University of Medical SciencePoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Bryl, Rut
, 
Maria Wieczorkiewicz

Maria Wieczorkiewicz

Department of Basic and Preclinical Sciences, Institute of Veterinary Medicine, Faculty of Biological and Veterinary Sciences, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Wieczorkiewicz, Maria
, 
Jakub Kulus

Jakub Kulus

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Kulus, Jakub
, 
Grzegorz Wąsiatycz

Grzegorz Wąsiatycz

Department of Veterinary Surgery, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Wąsiatycz, Grzegorz
, 
Dorota Bukowska

Dorota Bukowska

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Bukowska, Dorota
, 
Kornel Ratajczak

Kornel Ratajczak

Department of Veterinary Surgery, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Ratajczak, Kornel
, 
Jędrzej M. Jaśkowski

Jędrzej M. Jaśkowski

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Jaśkowski, Jędrzej M.
, 
James N. Petitte

James N. Petitte

Prestage Department of Poultry Science, North Carolina State UniversityRaleigh, NC, USA
Cerca questo autore su
Sciendo|Google Scholar
Petitte, James N.
, 
Paul Mozdziak

Paul Mozdziak

  • Prestage Department of Poultry Science, North Carolina State UniversityRaleigh, NC, USA
  • Physiology Graduate Program, North Carolina State UniversityRaleigh, NC, USA
Cerca questo autore su
Sciendo|Google Scholar
Mozdziak, Paul
, 
Leszek Pawelczyk

Leszek Pawelczyk

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Pawelczyk, Leszek
, 
Robert Z. Spaczyński

Robert Z. Spaczyński

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznań University of Medical SciencesPoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Spaczyński, Robert Z.
 e 
Paweł Antosik

Paweł Antosik

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Antosik, Paweł
  
31 dic 2020
Analysis of TGFB1, CD105 and FSP1 expression in human granulosa cells during a 7-day primary in vitro culture's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Pubblicato online: 31 dic 2020
Pagine: 152 - 157
Ricevuto: 06 ott 2020
Accettato: 17 nov 2020
DOI: https://doi.org/10.2478/acb-2020-0019
Parole chiave
© 2020 Artur Bryja, Wojciech Pieńkowski, Katarzyna Stefańska, Błażej Chermuła, Rut Bryl, Maria Wieczorkiewicz, Jakub Kulus, Grzegorz Wąsiatycz, Dorota Bukowska, Kornel Ratajczak, Jędrzej M. Jaśkowski, James N. Petitte, Paul Mozdziak, Leszek Pawelczyk, Robert Z. Spaczyński, Paweł Antosik, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

TGFB 1, CD105 and FSP1 expression in granulosa cells during 7-day in vitro culture. Data was presented like logarithm of fold change. Statistical analysis of the data was performed using the T-test and the differences were considered to be significant at the level of p<0.001 (***), p<0.01 (**), p<0.05 (*)
TGFB 1, CD105 and FSP1 expression in granulosa cells during 7-day in vitro culture. Data was presented like logarithm of fold change. Statistical analysis of the data was performed using the T-test and the differences were considered to be significant at the level of p<0.001 (***), p<0.01 (**), p<0.05 (*)

Oligonucleotide sequences of primers used for RT-qPCR analysis

GENEGENE ACCESSION NUMBERPRIMER SEQUENCE (5’-3’)PRODUCT SIZE (BP)
TGFB1NM_000660CCTTGCGGAAGTCAATGTACA GGCCTTTCCTGCTTCTCATG150
CD(ENG) 105BC014271CACTAGCCAGGTCTCGAAGG CTGAGGACCAGAAGCACCTC165
(SFSP1001 A4)CR450345TCTTGGGGAAAAGGACAGATGA CCCAACCACATCAGAGGAGT195
ACTBNM_001101CTCAGGAGGAGCAATGATCTTG AAAGACCTGTACGCCAACAC132
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Scienze biologiche, Biologia molecolare, Buiochimica
Feed RSS della rivista