The genus
During our surveys on plant-parasitic and free-living nematodes in Northern Iran, a new species of
The objectives of the present study were: (i) to provide an accurate description of the new species by an integrative approach to morphological and molecular characterization using the partial 18S and 28S D2 to D3 rRNA gene sequences, and (ii) to investigate the phylogenetic relationships of this neotylenchid nematode within the superfamily Sphaerularioidea.
Soil, root, and wood samples were randomly collected from different regions of eastern forests in Guilan Province, Northern Iran during 2015. Nematodes were recovered directly from the wood samples by the Whitehead tray method (Whitehead and Hemming, 1965). The extracted nematodes were observed and handpicked under a stereomicroscope. Adult specimens for microscopic observation were killed with gentle heat and fixed in a solution of FGA 4:1:1 (formaldehyde, glycerin, and acetic acid) and then processed to anhydrous glycerin (De Grisse, 1969). Permanent slides were made and examined with a Nikon E200 light microscope. Morphometric data were obtained with the aid of a drawing tube attached to an Olympus BH2 light microscope. Photomicrographs were taken with a digital camera attached to an Olympus BH2 light microscope. Line drawings were made and photographs were taken with a digital camera attached to an Olympus BH2 microscope.
Single nematode specimens were handpicked and with light microscopy and then individually transferred to 10 μl distilled water on a glass microscope slide, crushed with a pipette tip and collected in 50 μl AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0; Qiagen, Valencia, CA, USA) by pipette. DNA extracts were stored at −20°C until used as template for PCR amplification. The D2/D3 expansion segment of 28S rRNA gene was amplified using the forward D2A (5´–ACAAGTACCGTGAGGGAAAGTTG–3´) and reverse D3B (5´–TCGGAAGGAACCAGCTACTA–3´) primers (Nunn, 1992) and the partial 18S was amplified using primers 1096F (5´–GGTAATTCTGGAGCTAATAC-3´) and 1912R (5´–TTTACG GTCAGAACTAGGG–3´) (Holterman et al., 2006).
PCR cycle conditions for all rDNA regions were as follows: one cycle of 94°C for 2 min, followed by 35 cycles of 94°C for 30 s, annealing temperature of 55°C for 45 s, 72°C for 3 min, and finally one cycle of 72°C for 10 min. PCR products were purified after amplification using ExoSAP-IT (Affmetrix, USB Products), quantified using a Nanodrop spectrophotometer (Nanodrop Technologies) and used for direct sequencing in both directions using the primers referred to above.
The sequences were deposited into the GenBank database. DNA sequences were edited with ChromasPro1.5 2003-2009 (Technelysium Pty Ltd, Helensvale, Australia) and aligned using ClustalW (
Specific measurements are provided in Table 1.
Morphometrics of female of
Mycetophagous stage | Infective stage | ||
---|---|---|---|
Characters | Holotype female | Paratype females | Paratype females |
|
− | 10 | 4 |
L | 367 | 364.8 ± 33.7 (314-422) | 330.3 ± 17.6 (310-341) |
L' | 361 | 335.4 ± 33.3 (285-393) | 294.7 ± 15.3 (277-304) |
a | 18.6 | 21.1 ± 2.6 (18.1-26.5) | 28.3 ± 0.1 (28.2-28.4) |
b | 8.5 | 7.1 ± 0.9 (5.9-8.5) | 6.2 ± 1.8 (5.1-8.3) |
b' | 5.7 | 5.0 ± 0.9 (4.1-6.9) | 3.7 ± 0.4 (3.4-4.1) |
c | 13.4 | 12.4 ± 1.1 (10.8-14.6) | 9.3 ± 0.3 (9.0-9.4) |
c' | 2.4 | 3.3 ± 0.4 (2.4-3.8) | 5.1 ± 0.4 (4.7-5.4) |
V | 87.4 | 86.6 ± 0.7 (85.4-87.4) | 82.6 ± 0.6 (82.1-83.2) |
Head height | 1 | 1.4 ± 0.2 (1-1.5) | 2.1 ± 0.3 (2-2.5) |
Head width | 6 | 6.5 ± 0.5 (6-7) | 4.8 ± 0.3 (4.5-5) |
Stylet | 8 | 8.0 ± 0.2 (7.5-8.0) | 13.9 ± 0.9 (13-15) |
Excretory pore | 71 | 68.4 ± 5.2 (61-76) | 69 ± 6.5 (63-76) |
Hemizonid | 71 | 68.4 ± 5.2 (61-76) | 68.5 ± 6.6 (63-76) |
Pharynx | 46 | 51.4 ± 4.9 (46-63) | 54 ± 10.6 (41-64) |
Overlapping | 22 | 23.1 ± 7.5 (11-33) | 32.3 ± 5.9 (29-41) |
Body width | 21 | 17.5 ± 2.8 (14-22) | 11.8 ± 0.5 (11-12) |
Head-vulva | 341 | 316.0 ± 30.8 (268-367) | 272.7 ± 12.7 (258-281) |
Vulva-anus | 20 | 19.4 ± 3.4 (15-26) | 22 ± 3.0 (19-25) |
Tail | 29 | 29.4 ± 1.3 (27-32) | 35.7 ± 2.5 (33-38) |
These are small nematodes with cylindrical body, gradually tapered toward both ends and straight or slightly curved upon fixation. Cuticle is with fine transverse striae, annulations less than 1 µm apart. Lateral field is with eight lines near vulva, reduced to four lines anteriorly and near the tail. Cephalic region is low, flattened, with rounded sides and continuous with body contour. Stylet is short, with distinct and posteriorly directed basal knobs. Conus occupies ca 33 to 47% of its total length. Orifice of dorsal pharyngeal gland is 0.5 to 1 μm posterior to stylet knobs. Pharynx is with a fusiform corpus, valveless, without distinct metacorpus. Subventral gland orifice is halfway between stylet basal knobs and the pharynx-intestine junction. Isthmus is narrow, short, and surrounded by nerve ring. Dorsal pharyngeal gland is short, overlapping intestine dorsally, with only one nucleus seen. Excretory pore is 71 μm (holotype) from anterior end. Hemizonid is at the level of excretory pore. Deirids is distinct, 1 to 13 μm posterior to hemizonid. Nerve ring and barely visible pharyngo-intestinal junction are either overlapping each other or junction is sometimes slightly posterior to nerve ring. Reproductive system is monodelphic and ovary is outstretched with two to three rows of oocytes in the multiplication zone. Spermatheca is invisible, crustaformeria is made up 8 to 12 columns of cells. Vagina is oblique, directed anteriorly. Vulva is a broad transverse slit, vulval lips nonprotuberant. Post-uterine sac is absent. Vulva-anus distance is less than tail length. Rectum and anus are distinct. Tail is conical, gradually tapering toward a pointed tip 2.4 to 3.8 times of the body width at the anus.
Not found.
These are small nematodes with almost straight body upon fixation. Cuticle is with fine transverse striae. Cephalic region is higher than mycophagous females, asymmetric, and continuous with body contour. Stylet is 13 to 15 μm long, with a wide lumen, without basal knobs but with a bit of inflation. The tip of the stylet is bent. Pharynx is with approximately cylindrical corpus and basal pharyngeal bulb developed with dorsal and ventral gland nuclei. Excretory pore is 63 to 76 μm from anterior end. Hemizonid is at the level of excretory pore or just anterior to that. Reproductive system is monodelphic and ovary is short with short germinal zone. Vagina is oblique, directed anteriorly, vulval lips nonprotuberant. Post-uterine sac is absent. Vulva-anus distance is less than tail length. Tail is conical, gradually tapering toward a pointed tip 4.7 to 5.4 times of the body width at the anus.
Holotype female, three paratype mycetophagus females, and two infective females (Slides NDG001 and NDGR002, NDG006) deposited at Nematode Collection of Department of Plant Protection, College of Agricultural and Natural Resources, University of Tehran, Karaj, Iran. Four female paratypes deposited at National Nematode Collection of the Department of Nematology, Iranian Research Institute of Plant protection, Tehran, Iran. Two paratype mycetophagus females and two infective females deposited in USDA Nematode Collection, Beltsville, MD, USA.
The specific epithet refers to the province of occurrence of the new species.
The new species (based on the mycetophagous stage) is characterized by body length of 314 to 422 μm long, eight incisures in the lateral field and the position of the excretory pore and hemizonid at the same level (see Table 2).
Comparison of
Species | L | a | b | c | V | Stylet | Median corporeal chamber | Excretory pore relative to hemizonida | Tail | Lib | Male | Infective stage |
---|---|---|---|---|---|---|---|---|---|---|---|---|
|
314-422 | 18.1-26.5 | 5.9-8.5 | 10.8-14.6 | 85.4-87.4 | 7.5-8 | – | SL | 27-32 | 8 at level of vulva | – | + |
|
620-13,60 | 21-50 | 7.7-16 | 19.5-39.3 | 90-95 | 6-11 | + | P | 21-43 | 6-7 | + | – |
|
693 | 31.2 | 19.8 | 91.9 | 9.4 | – | P | 5 | – | – | ||
|
970-1,400 | 18-26 | 8-16.9 | 32-33.6 | 92-93 | 7.3-9 | – | P | 30-47 | 8-10 | – | – |
|
760-990 | 34-49 | 13.3-17.7 | 19.6-22.8 | 92.2-93.5 | 6-7 | – | P | 35-44 | 6 | + | – |
|
660-960 | 19-26 | 7.9 | 29 | 92-93.5 | 7-9 | + | A | 29-34 | Indistinct | + | + |
|
1,490-2,700 | 34.6-62.6 | 15.5-26.5 | 46.6-66.9 | 94.6-96.2 | 10-11 | – | A or SL | 7-9 at level of vulva | + | + | |
|
1,760-2,200 | 40-53.7 | 16.3-21.3 | 44-60 | 95.1-95.9 | 11-12 | – | A | 31-47 | 7-8 at level of vulva | + | + |
|
889-1,026 | 38-43 | 10.1-12.8 | 31.3-37.1 | 93.5-95.9 | 8-11 | – | A | 27-29 | 11-12 at midbody | + | + |
Amplification of the partial 18S and 28S D2/D3 rRNA gene sequences from
Molecular phylogenetic analysis based on rRNA gene sequences suggested that the new species belongs to the
Phylograms reveal that the new species is close to
Among the nominal species, the position of the excretory pore differs dramatically, either relative to the anterior end, or to the hemizonid. Its position relative to the hemizonid has been documented as the most important diagnostic character to differentiate species (Chitambar, 1991; Yu et al., 2013). All the putative dimorphic species have the excretory pore anterior to the hemizonid, while almost all of the other presumed non-dimorphic species, with the exception of
In addition to the morphological character (distance between the hemizonid and the excretory pore in the mycophagous form), Kanzaki et al. (2016) distinguished