Description of Deladenus gilanica n. sp. (Hexatylina: Neotylenchidae) isolated from wood of black pine in Northern Iran

Soil, root, and wood samples were randomly collected from different regions of eastern forests in Guilan Province, Northern Iran during 2015. Nematodes were recovered directly from the wood samples by the Whitehead tray method (Whitehead and Hemming, 1965). The extracted nematodes were observed and handpicked under a stereomicroscope. Adult specimens for microscopic observation were killed with gentle heat and fixed in a solution of FGA 4:1:1 (formaldehyde, glycerin, and acetic acid) and then processed to anhydrous glycerin (De Grisse, 1969). Permanent slides were made and examined with a Nikon E200 light microscope. Morphometric data were obtained with the aid of a drawing tube attached to an Olympus BH2 light microscope. Photomicrographs were taken with a digital camera attached to an Olympus BH2 light microscope. Line drawings were made and photographs were taken with a digital camera attached to an Olympus BH2 microscope.

Single nematode specimens were handpicked and with light microscopy and then individually transferred to 10 μl distilled water on a glass microscope slide, crushed with a pipette tip and collected in 50 μl AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0; Qiagen, Valencia, CA, USA) by pipette. DNA extracts were stored at −20°C until used as template for PCR amplification. The D2/D3 expansion segment of 28S rRNA gene was amplified using the forward D2A (5´–ACAAGTACCGTGAGGGAAAGTTG–3´) and reverse D3B (5´–TCGGAAGGAACCAGCTACTA–3´) primers (Nunn, 1992) and the partial 18S was amplified using primers 1096F (5´–GGTAATTCTGGAGCTAATAC-3´) and 1912R (5´–TTTACG GTCAGAACTAGGG–3´) (Holterman et al., 2006).

PCR cycle conditions for all rDNA regions were as follows: one cycle of 94°C for 2 min, followed by 35 cycles of 94°C for 30 s, annealing temperature of 55°C for 45 s, 72°C for 3 min, and finally one cycle of 72°C for 10 min. PCR products were purified after amplification using ExoSAP-IT (Affmetrix, USB Products), quantified using a Nanodrop spectrophotometer (Nanodrop Technologies) and used for direct sequencing in both directions using the primers referred to above.

The sequences were deposited into the GenBank database. DNA sequences were edited with ChromasPro1.5 2003-2009 (Technelysium Pty Ltd, Helensvale, Australia) and aligned using ClustalW (http://workbench.sdsc.edu; Bioinformatics and Computational Biology Group, Department of Bioengineering, UC San Diego, CA). All available species of Deladenus and some other Hexatylina species from GenBank were also selected for phylogenetic analysis. Outgroup taxa for each data set was chosen according to previous published data (Esmaeili et al., 2016). The model of base substitution in the sequences data were evaluated using MODELTEST version 3.06 (Posada and Criandall, 1998) based on the Akaike-supported model (Arnold, 2010). Bayesian analysis was performed to confirm the tree topology for each gene separately using MrBayes 3.1.0 (Huelsenbeck and Ronquist, 2001) running the chain for 1,000,000 generations and setting the ‘burnin’ at 1,000. Markov Chain Monte Carlo methods were used within a Bayesian framework to estimate the posterior probabilities (pp) of the phylogenetic trees (Larget and Simon, 1999) using the 50% majority rule. The λ ² test for homogeneity of base frequencies and phylogenetic trees was performed using PAUP* version 4.0 (Sinauer Associates, Inc., Publishers, Sunderland, MA).

Figs. 1 and 2 show line drawings of D. gilanica n. sp.

Figure 1:

Figure 2:

Specific measurements are provided in Table 1.

D. gilanica n. sp. was obtained from the wood samples of a dead black pine tree (Pinus nigra) of Siahkal region in Guilan Province, Northern Iran (GPS coordinates: N 37° 64´, E 49° 51´).

Holotype female, three paratype mycetophagus females, and two infective females (Slides NDG001 and NDGR002, NDG006) deposited at Nematode Collection of Department of Plant Protection, College of Agricultural and Natural Resources, University of Tehran, Karaj, Iran. Four female paratypes deposited at National Nematode Collection of the Department of Nematology, Iranian Research Institute of Plant protection, Tehran, Iran. Two paratype mycetophagus females and two infective females deposited in USDA Nematode Collection, Beltsville, MD, USA.

The specific epithet refers to the province of occurrence of the new species.

The new species (based on the mycetophagous stage) is characterized by body length of 314 to 422 μm long, eight incisures in the lateral field and the position of the excretory pore and hemizonid at the same level (see Table 2).

Deladenus gilanica n. sp. differs from all other described Deladenus species by the shorter body and the position of the excretory pore relative to the hemizonid. Due to the position of excretory pore and hemizonid, the new species can be compared with some species like D. durus, D. aridus (Andrássy, 1957), D. obesus (Thorne, 1941), D. processus (Tomar et al., 2015), D. oryzae (Bajaj, 2015), D. wilsoni, D. proximus (Bedding, 1974), and D. posteroporus (Yu et al., 2017). It can be distinguished from these species by having a shorter body, position of the excretory pore and hemizonid, anteriorly located vulva (less V index), longer and conical tail (less c index) with pointed tip and shape of lip region, and also by the stylet and tail shape in infective females.

Amplification of the partial 18S and 28S D2/D3 rRNA gene sequences from D. gilanica n. sp. specimens yielded single fragments of approximately 900 and 800 bp, respectively, based on gel size. The partial 18S rRNA gene sequence of D. gilanica n. sp. (GenBank Accession No. MF043926) was less than 96% homologous to any available DNA sequences from GenBank. The BlastN search revealed the highest match with sequences of a member of the Neotylenchidae (KY907662) and several isolates of Fergusobia leptospermum (Davies et al., 2018) (KX611458, FJ393268, AY589292, FJ393270, AY589303, KF209340) with 95 to 96% identity, with substitutions ranging from 50 to 65 and from 6 to 13 indels. The 28S D2/D3 sequence of D. gilanica n. sp. (MF043927) was less than 88% homologous with any available DNA sequences from GenBank. The BlastN search revealed the highest match with D. posteroporus (KX094978) and an undescribed/unidentified species of the genus (JX104313) with 44 to 60 substitutions and 8 to 15 indels (Figs. 3 and 4).

Figure 3:

Figure 4:

Molecular phylogenetic analysis based on rRNA gene sequences suggested that the new species belongs to the Deladenus clade with 100% bootstrap support, but the status within the genus was not clearly resolved. Although posterior probability support was not high for any Deladenus clade besides that for the three isolates of D. siricidicola, the inferred tree largely agrees with the tree of Kanzaki et al. (2016, 2017).

Phylograms reveal that the new species is close to D. siricidicola complex/clade (D. canii, Bedding, 1968; D. nitobei, Kanzaki et al., 2016, and D. siricidicola); all share the position of the excretory pore relative to the hemizonid and support the morphological characteristics. The vast majority of described Deladenus species have not yet been sequenced, and thus inference phylogenetic relationships will require molecular characterization of further species.

Among the nominal species, the position of the excretory pore differs dramatically, either relative to the anterior end, or to the hemizonid. Its position relative to the hemizonid has been documented as the most important diagnostic character to differentiate species (Chitambar, 1991; Yu et al., 2013). All the putative dimorphic species have the excretory pore anterior to the hemizonid, while almost all of the other presumed non-dimorphic species, with the exception of D. apopkaetus (Chitambar, 1991), which have the excretory pore posterior to the hemizonid. The distances between the two structures vary between species of Deladenus and may overlap. We observed that the hemizonid and the excretory pore are located at the same level in D. gilanica n. sp., which is a unique character among reported species of the genus.

In addition to the morphological character (distance between the hemizonid and the excretory pore in the mycophagous form), Kanzaki et al. (2016) distinguished D. nitobei and D. siricidicola from the other Deladenus species reported from Japan by their preferences in host wasp and food source. Bedding and Akhurst (1978) reported that Deladenus species were fungus specific. A detailed field survey of the insect host-nematode-fungi associations is necessary to understand the bionomics of the new species.