- Détails du magazine
- Format
- Magazine
- eISSN
- 1336-9083
- Première parution
- 22 Apr 2006
- Périodicité
- 4 fois par an
- Langues
- Anglais
The genus
Specimens were collected at Parys, Free State Province, close to the river in association with the natural grass (S 26° 54’ 37.336”, E 27°27’ 24.582”). The specimens were extracted using the tray method and were fixed with a hot 4 % formaldehyde solution and transferred to anhydrous glycerin using the De Grisse (1969) method. The nematodes were processed and studied at Aquacultutre Research Unit, University of Limpopo. The classification provided by Zhao (2009) was used for the taxonomical study of
DNA extraction was done using the Chelex method (Straube & Juen, 2013). Five specimens of the species were hand-picked with a fine tip needle and transferred to a 1.5 ml Eppendorf tube containing 20 μl double distilled water. The nematodes in the tube were crushed with the tip of a fine needle and vortexed. Thirty microliters of 5 % Chelex® 50 and 2 μL of proteinase K was added to the microcentrifuge tube that contained the crushed nematodes and mixed. The microcentrifuge tube with the nematode lysate was incubated at 56 °C for two hours and then incubated at 95 °C for 10 minutes to deactivate the proteinase K and finally spun for 2 min at 16000 rpm (Shokoohi, 2021). The supernatant was then extracted from the tube and stored at –20 °C. Following this step, the forward and reverse primers, D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’), D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al., 1999), were used in the PCR reactions for partial amplification of the D2/D3 region of 28S. PCR was conducted with 8 μl of the DNA template, 12.5 μl of 2X PCR Master Mix Red (Promega, USA), 1 μl of each primer (10 pmol μl-1), and ddH2O for a final volume of 30 μl. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program: initial denaturation for 3 min at 94 °C, 37 cycles of denaturation for 45 s at 94 °C; 56 °C annealing temperature for 45 s and 72 °C for 1 min, and finally an extension step of 6 min at 72 °C followed by a temperature on hold at 4 °C. After DNA amplification, 4 μl of PCR product was loaded on a 1 % agarose gel in TBE buffer (40 mM Tris, 40 mM boric acid, and one mM EDTA) for evaluation of the DNA bands. The band was stained with RedGel and visualized and photographed on a UV transilluminator. The PCR product was stored at –20 °C. Finally, Inqaba Biotech (South Africa) purified the PCR product for sequencing.
The ribosomal DNA sequences were analyzed and edited with BioEdit (Hall, 1999) and aligned using CLUSTAL W (Thompson et al., 1994). Phylogenetic tree was generated using the Bayesian inference method as implemented in the program Mr Bayes 3.1.2 (Ronquist & Huelsenbeck, 2003). The GTR+I+Γ model was selected using jModeltest 2.1.10 (Guindon & Gascuel, 2003; Darriba et al., 2012). Analysis was initiated with a random starting tree and ran with the Markov chain Monte Carlo (MCMC) for 106 generations for 28S rDNA. The tree was visualized with the TreeView program. Also, as outgroups,
The author confirms that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered. The author confirms that the conducted research is neither related to human nor animal use.
Morphological characterization (ten females in a good state of preservation)
Fig. 1
Measurements of females of
| Character | Present study South Africa | Pham et al., 2013 China |
|---|---|---|
| n | 10 females | 23 females |
| L | 1075.0 ± 36.5 (1037 – 1128) | 1152 – 1631 |
| a | 31.0 ± 3.3 (27.3 – 35.5) | 23.3 – 36.4 |
| b | 5.4 ± 0.2 (5.1 – 5.6) | 5.0 – 6.6 |
| c | 18.2 ± 1.8 (16.1 – 19.8) | 13.4 – 19.7 |
| c' | 3.0 ± 0.4 (2.5 – 3.4) | 2.6 – 3.6 |
| V | 64.0 ± 1.2 (62 – 65) | 60 – 70 |
| Lip region width | 17.6 ± 1.0 (16 – 19) | 19 – 30 |
| Labial setae | 11.4 ± 1.7 (10 – 15) | 11 – 16 |
| Dorsal tooth from the anterior end | 14.5 ± 3.2 (10 – 20) | 11 – 21 |
| Amphid position from the anterior end | 13.5 ± 0.7 (13 – 14) | 12 – 17 |
| Nerve ring from the anterior end | 87.6 ± 2.1 (85 – 90) | 99 – 139 |
| Pharynx | 170.1 ± 10.5 (155 – 186) | 163 – 164* |
| Neck length | 198.7 ± 6.1 (187 – 204) | 183 – 186* |
| Cardia length | 20.6 ± 3.1 (18 – 26) | 20 – 27 |
| Cardia diameter | 7.3 ± 2.1 (5 – 9) | 8.5 – 14 |
| Body diameter at neck base | 30.8 ± 4.0 (25 – 37) | 34 – 36* |
| Body diameter at mid-body | 33.7 ± 2.8 (25 – 38) | 43* |
| Body diameter at anus | 21.0 ± 2.4 (17 – 24) | 23 – 29* |
| Tail length | 61.2 ± 8.6 (53 – 72) | 73 – 103 |
| Anterior end to vulva | 696.4 ± 49.5 (653 – 776) | 757 – 1045 |
* = extracted from original drawing
The forward D2 and reverse D3 primers of 28S rDNA for
Our phylogenetic analysis using 28S rDNA, placed the South African
Fig. 2
28S rDNA Bayesian tree inferred from known and newly sequenced
Fig. 1
Fig. 2
Measurements of females of Tripylina zhejiangensis from South Africa. All measurements are in μm and in the form: mean ± SD (range), except for the ratio.
| Character | Present study South Africa | |
|---|---|---|
| n | 10 females | 23 females |
| L | 1075.0 ± 36.5 (1037 – 1128) | 1152 – 1631 |
| a | 31.0 ± 3.3 (27.3 – 35.5) | 23.3 – 36.4 |
| b | 5.4 ± 0.2 (5.1 – 5.6) | 5.0 – 6.6 |
| c | 18.2 ± 1.8 (16.1 – 19.8) | 13.4 – 19.7 |
| c' | 3.0 ± 0.4 (2.5 – 3.4) | 2.6 – 3.6 |
| V | 64.0 ± 1.2 (62 – 65) | 60 – 70 |
| Lip region width | 17.6 ± 1.0 (16 – 19) | 19 – 30 |
| Labial setae | 11.4 ± 1.7 (10 – 15) | 11 – 16 |
| Dorsal tooth from the anterior end | 14.5 ± 3.2 (10 – 20) | 11 – 21 |
| Amphid position from the anterior end | 13.5 ± 0.7 (13 – 14) | 12 – 17 |
| Nerve ring from the anterior end | 87.6 ± 2.1 (85 – 90) | 99 – 139 |
| Pharynx | 170.1 ± 10.5 (155 – 186) | 163 – 164* |
| Neck length | 198.7 ± 6.1 (187 – 204) | 183 – 186* |
| Cardia length | 20.6 ± 3.1 (18 – 26) | 20 – 27 |
| Cardia diameter | 7.3 ± 2.1 (5 – 9) | 8.5 – 14 |
| Body diameter at neck base | 30.8 ± 4.0 (25 – 37) | 34 – 36* |
| Body diameter at mid-body | 33.7 ± 2.8 (25 – 38) | 43* |
| Body diameter at anus | 21.0 ± 2.4 (17 – 24) | 23 – 29* |
| Tail length | 61.2 ± 8.6 (53 – 72) | 73 – 103 |
| Anterior end to vulva | 696.4 ± 49.5 (653 – 776) | 757 – 1045 |
Prevalence of ruminant paramphistomosis and comparative histopathology of the infected rumens in Narowal district, Punjab, Pakistan Inducing systemic acquired resistance (SAR) against root-knot nematode Meloidogyne javanica and evaluation of biochemical changes in cucumber rootEnterobius vermicularis infection: a cross-sectional study in preschool and school children in the North-Western part of SloveniaAdvantages and limitations of microscopy and molecular detections for diagnosis of soil-transmitted helminths: An overview First report of Aphelenchoides bicaudatus (Imamura, 1931 ) Filipjev and Schuurmans Stekhoven, 1941 associated with grass in South AfricaEnterobius vermicularis infections in IraqDifferential activity of human leukocyte extract on systemic immune response and cyst growth in mice with Echinococcus multilocularis infection after oral, subcutaneous and intraperitoneal routes of administrationNew Parasitic records of Aves: Phasianidae ( Alectoris chukar ) in Malakand division northern, PakistanEpidemiological survey on gastrointestinal and pulmonary parasites in cats around Toulouse (France) A large adnexal tumor caused by Enterobius vermicularis mimicking malignancy