Genetic basis of acute myeloid leukemia (AML): The most common molecular changes in patients with normal karyotype
09 août 2022
À propos de cet article
Catégorie d'article: Review
Publié en ligne: 09 août 2022
Pages: 339 - 344
Reçu: 04 nov. 2021
Accepté: 28 mars 2022
DOI: https://doi.org/10.2478/ahem-2022-0034
Mots clés
© 2022 Karolina Matiakowska-Bryk et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Fig. 1
![“Two-hit model” according to Gilliland [5]](https://sciendo-parsed.s3.eu-central-1.amazonaws.com/6470896671e4585e08a9f6cb/j_ahem-2022-0034_fig_001.jpg?X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Content-Sha256=UNSIGNED-PAYLOAD&X-Amz-Credential=AKIA6AP2G7AKOUXAVR44%2F20250907%2Feu-central-1%2Fs3%2Faws4_request&X-Amz-Date=20250907T135119Z&X-Amz-Expires=3600&X-Amz-Signature=54e2cd4cea730523fe9b39bb0335ca08a40e34a10ea4b90963fdd04daf6dfffa&X-Amz-SignedHeaders=host&x-amz-checksum-mode=ENABLED&x-id=GetObject)
The most common mutations in the NPM1 gene [15]
No | Mutation type/name | DNA sequences: wild-type (black) and mutated (red) | |||||||
---|---|---|---|---|---|---|---|---|---|
1. | No mutation (wt) | gatctct | - | g | - | gcagt | - | ggagg | aagtctctttaagaaaatag |
2. | A | gatctct | - | g | TCTG | gcagt | - | ggagg | aagtctctttaagaaaatag |
3. | B | gatctct | - | g | CATG | gcagt | - | ggagg | aagtctctttaagaaaatag |
4. | C | gatctct | - | g | CGTG | gcagt | - | ggagg | aagtctctttaagaaaatag |
5. | D | gatctct | - | g | CCTG | gcagt | - | ggagg | aagtctctttaagaaaatag |
6. | E | gatctct | - | g | - | gcagt | CTCTTGCCC | - | aagtctctttaagaaaatag |
7. | F | gatctct | - | g | - | gcagt | CCCTGGAGA | - | aagtctctttaagaaaatag |
8. | G | gatctct | - | g | - | gcagt | GCTTCGCC | - | aagtctctttaagaaaatag |
9. | H | gatctct | - | g | - | gcagt | GTTTTTCAA | - | aagtctctttaagaaaatag |
10. | J | gatctct | - | g | - | gcagt | CTCTTTCTA | - | aagtctctttaagaaaatag |
11. | L | gatctct | CCCG | g | - | gcagt | - | - | aagtctctttaagaaaatag |
12. | K | gatctct | - | g | - | gcagt | CCCTTTCCA | - | aagtctctttaagaaaatag |
13. | M | gatctct | - | g | TAGC | gcagt | - | ggagg | aagtctctttaagaaaatag |
14. | N | gatctct | - | g | CCAC | gcagt | - | ggagg | TCTCTTTaagaaaatag |
Risk stratification of AML according to ELN [7]
Risk category | Genetic abnormality |
---|---|
Favorable |
t(8;21)(q22;q22) inv(16)(p13q22) or t(16;16)(p13;q22) mutated biallelic mutated |
Intermediate |
t(9;11)(p21;q23) cytogenetic abnormalities not classified as favorable or adverse, mutated wild type |
Adverse |
t(6;9)(p23;q34) t(v;11q23.3); t(9;22)(q34;q11) inv(3)(q21.3q26.2) or t(3;3)(q21.3;q26.2); −5 or del(5q); −7; −17 or del(17p), complex or monosomal karyotype, wild type mutated |