<abstract xmlns="http://www.w3.org/1999/xhtml"><p>Granulosa cells play an important role in follicle development, maturation, and atresia. They are a cellular source of the two most important ovarian steroids, namely, estradiol and progesterone and are also crucial for bidirectional communication with the oocyte, thus being involved in the regulation of its growth, development and function. Growing body of evidence suggests that granulosa cells cultured <italic>in vitro</italic> display stemness and transdifferentiation potential. Together with the fact that they can be easily collected during IVF procedures, these properties of GCs may be of particular interest for both regenerative medicine and transplantology. Establishment of <italic>in vitro</italic> cell culture and its thorough characterization, including molecular, is crucial for future potential utilization of human granulosa cells in design of engineered tissue grafts or cell-based therapies, in particular targeted at female infertility. Nevertheless, the transcriptomic alterations which may occur during <italic>in vitro</italic> culture of granulosa cells are still largely uncharacterized. The aim of this study was to examine expression changes of three genes encoding histone demethylases which serve as transcription coactivators in short term <italic>in vitro</italic> cell culture of human granulosa cells. The study groups consisted of 14 patients, aged 18–40 years undergoing <italic>in vitro</italic> fertilization (IVF). Expression level assessment was performed after 24 h, 48 h, 72 h, 96 h, 120 h, 144 h and 168 h of <italic>in vitro</italic> primary cell culture utilizing RT-qPCR technique. Upregulation of <italic>PHF2</italic> expression in all time points of the culture was observed, whereas the tendency of <italic>JHDM1D</italic> and <italic>PHF8</italic> was mainly to decrease in expression level. Further study on a larger population would be required in order to confirm the presented tendencies.</p><p><bold>Running title:</bold> Expression pattern of selected histone demethylases in human granulosa cells</p></abstract>

Granulosa cells play an important role in follicle development, maturation, and atresia. They are a cellular source of the two most important ovarian steroids, namely, estradiol and progesterone and are also crucial for bidirectional communication with the oocyte, thus being involved in the regulation of its growth, development and function. Growing body of evidence suggests that granulosa cells cultured in vitro display stemness and transdifferentiation potential. Together with the fact that they can be easily collected during IVF procedures, these properties of GCs may be of particular interest for both regenerative medicine and transplantology. Establishment of in vitro cell culture and its thorough characterization, including molecular, is crucial for future potential utilization of human granulosa cells in design of engineered tissue grafts or cell-based therapies, in particular targeted at female infertility. Nevertheless, the transcriptomic alterations which may occur during in vitro culture of granulosa cells are still largely uncharacterized. The aim of this study was to examine expression changes of three genes encoding histone demethylases which serve as transcription coactivators in short term in vitro cell culture of human granulosa cells. The study groups consisted of 14 patients, aged 18–40 years undergoing in vitro fertilization (IVF). Expression level assessment was performed after 24 h, 48 h, 72 h, 96 h, 120 h, 144 h and 168 h of in vitro primary cell culture utilizing RT-qPCR technique. Upregulation of PHF2 expression in all time points of the culture was observed, whereas the tendency of JHDM1D and PHF8 was mainly to decrease in expression level. Further study on a larger population would be required in order to confirm the presented tendencies.Running title: Expression pattern of selected histone demethylases in human granulosa cells

Histone demethylases JHDM1D, PHF2 and PHF8 expression pattern in granulosa cells obtained from patients undergoing IVF procedure during short-term IVC

Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology

Division of Perinatology and Women's Diseases

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine

Department of Basic and Preclinical Sciences, Institute of Veterinary Medicine, Faculty of Biological and Veterinary Sciences

Department of Veterinary Surgery, Institute of Veterinary Medicine

Medical Journal of Cell Biology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Granulosa cells play an important role in follicle development, maturation, and atresia. They are a cellular source of the two most important ovarian steroids,...

GENE NAME	5′ → 3′ SEQUENCE OF THE FORWARD PRIMER	5′ → 3′ SEQUENCE OF THE FORWARD PRIMER	PRODUCT SIZE (BP)
JHDM1D	TCCCTTCACCTACATTTTCTG	TGCCTGCCTCGCCACATC	89
PHF2	CCATCGGTGCCAAGACAGG	GGGGAGGTGGTGTTAGGAG	164
PHF8	CCCTCGCCATCATTCACTG	TTCTCCCTCTTCCCGCTGT	146

STEP		TEMPERATURE [°C]	TIME [MIN]	NUMBER OF CYCLES
Preincubation		95	600	1
Amplification	Denaturation	95	15	40
	Annealing	58	15
	Elongation	72	15
Melting		95	60	1
		40	60
		70	1
		95	1
Cooling		37	30	1

Histone demethylases JHDM1D, PHF2 and PHF8 expression pattern in granulosa cells obtained from patients undergoing IVF procedure during short-term IVC

Publié en ligne: 30 mars 2021

Pages: 1 - 7

Reçu: 04 janv. 2021

Accepté: 29 janv. 2021

DOI: https://doi.org/10.2478/acb-2021-0001

Mots clés
human granulosa cells, GCs, histone demethylases, epigenetic changes, expression level, short-term cell culture

© 2021 Rut Bryl et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1

Oligodeoxynucleotides designed to detect the expression levels of the studied genes

Thermal profile of RT-qPCRs

Histone demethylases JHDM1D, PHF2 and PHF8 expression pattern in granulosa cells obtained from patients undergoing IVF procedure during short-term IVC

Publié en ligne: 30 mars 2021

Pages: 1 - 7

Reçu: 04 janv. 2021

Accepté: 29 janv. 2021

DOI: https://doi.org/10.2478/acb-2021-0001

Mots cléshuman granulosa cells, GCs, histone demethylases, epigenetic changes, expression level, short-term cell culture

© 2021 Rut Bryl et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1

Oligodeoxynucleotides designed to detect the expression levels of the studied genes

Thermal profile of RT-qPCRs

Mots clés
human granulosa cells, GCs, histone demethylases, epigenetic changes, expression level, short-term cell culture