With the increasing number of diabetic patients, diabetes, especially type 2 diabetes mellitus (T2DM), is becoming an increasingly prevalent health issue in the 21st century (Cao et al. 2020; Wang et al. 2021a). Hyperglycemia is the main symptom of T2DM, primarily caused by insulin resistance or inadequate insulin production (Wu et al. 2021). The treatment of T2DM mainly includes two standard methods. The one is insulin injections, which could result in insulin resistance. Another method is orally administered hypoglycemic medications, which may cause adverse reactions and subsequent failures (Sun et al. 2020). It necessitates the development of non-toxic treatment options with hypoglycemic effects without side effects.
Many drugs used to treat diabetes, acarbose and miglitol are among the most commonly used. Unfortunately, these drugs have some adverse effects, including diarrhea, flatulence, and abdominal pain (Rosas-Ramírez et al. 2018). Probiotics have a promising future in treating T2DM in humans, so it is important to develop alternatives to current antidiabetic medicine (Awad et al. 2018). It has been demonstrated that probiotics, which are generally considered to be ingested microorganisms that have favorable effects on the host, are effective in preventing and alleviating T2DM through different mechanisms, such as lowering blood glucose or inhibiting pro-inflammatory markers (Hill et al. 2014; Sharma and Shukla 2020; Sun et al. 2020; Zendeboodi et al. 2020; Zepeda-Hernández et al. 2021).
By inhibiting the action of α-amylase and α-glucosidase, carbohydrates are not broken down and absorbed as quickly, reducing the glucose rate that enters the bloodstream after a meal (Barros et al. 2021; Zhang et al. 2022). It helps reduce post-meal spikes in blood glucose levels, which benefits people with diabetes. Therefore, inhibiting the action of α-amylase and α-glucosidase is critical to treating T2DM (Gong et al. 2020). The probiotics that may improve T2DM were screened by examining the inhibitory activities of α-amylase and α-glucosidase. The effects of multiple probiotic strains are superior to those of a single strain in terms of gut function, gut microbiota regulation, intestinal inflammation, depression, and neurological disorders (Chapman et al. 2011; Li et al. 2019; Dehghani et al. 2022).
The 16S rDNA sequencing was used to confirm the identification of the selected strain (Jomehzadeh et al. 2020; Lin et al. 2020). Therefore, four novel strains of
The use of fecal samples is approved by a healthy fecal provider who has not taken any medication in the past year and has undergone a professional physical examination at the Chinese People's Liberation Army (PLA) General Hospital (Beijing, China). Fecal samples (10 g) from healthy adults were resuspended in 100 ml de Man, Rogosa and Sharp medium (MRS; Beijing Land Bridge Technology Co., Ltd., China) and stationary cultivated for 24 h at 37°C. Then, cultures were diluted and spread onto the MRS agar plates. After cultivation for 24 h at 37°C, colonies were picked up and added to 10 ml MRS medium. After cultivation for 12 h at 37°C, the culture broth was added to 10 ml MRS medium with 5% (v/v) inoculation volume. Finally, a diluted suspension of the culture broth was plated onto MRS agar plates, and colonies were counted.
Total DNA was extracted from bacterial cultures in MRS broth. 200 μl of cultures was collected in 1.5 ml tube and centrifuged at 9,000 ×
Based on Barapatre et al. (2015) with some variations, the α-amylase inhibitory activity was measured. 10 μl of 0.02 M sodium phosphate buffer (pH 6.9) containing α-amylase (0.5 mg/ml) and 50 μl bacterial suspension (109 CFU/ml) were mixed and incubated at 37°C for 10 min. Then, 50 μl of 1% (w/v) starch dissolved in 0.02 M sodium phosphate buffer (pH 6.9) was added and further incubated at 37°C for 10 min. The reaction was terminated by adding 20 μl of DNS reagent. Then, the reaction mixture was centrifuged at 8,000 ×
The α-glucosidase inhibitory activity was determined by the method of Nguyen et al. (2018). The mixture included 50 μl of 0.1 M phosphate buffer (pH 6.9), 20 μl of bacterial suspension (109 CFU/ml), and 20 μl of p-nitro-phenyl-α-d-glucopyranoside (PNPG, 5 mM). After the mixture was incubated for 10 min at 37°C, 10 μl of 0.5 U/ml α-glucosidase solution was added. The mixture was incubated for 10 min at 37°C; then the reaction was stopped by adding 100 μl of sodium carbonate (0.02 M). The reaction mixture was centrifuged at 8,000 ×
Strain survivability was assessed using an
Bacterial adhesion to Caco-2 cell cultures was investigated according to Fonseca et al. (2021). After cultivation in MRS broth for 24 h at 37°C and washing twice with phosphate-buffered solution, the bacteria were resuspended in Dulbecco's Modified Eagle Medium (DMEM; Sigma-Aldrich Co., Ltd., USA) at a density of 109 CFU/ml. Caco-2 cells were then cultivated for 1 h at 37°C in an atmosphere of 5% CO2 with a 1 ml culture suspension of bacteria. After being washed three-time with PBS, treated with 1 ml Triton-X solution, and cultivated for 5 min at 37°C, the culture medium was serially diluted and plated onto MRS agar to count the bacterial colonies:
After incubating at 37°C for 24 h, four
An L9 (34) orthogonal table was designed. The inhibitory activities to α-amylase and α-glucosidase were used as the inspection index.
Factors and levels of the orthogonal experiment of
Level | A ( |
B ( |
C ( |
D ( |
---|---|---|---|---|
1 | 108 | 108 | 108 | 108 |
2 | 109 | 109 | 109 | 109 |
3 | 1010 | 1010 | 1010 | 1010 |
All animals were maintained in a specific pathogen-free (SPF) environment. Under the 12-hour light cycle, the animals were permitted to access food and water at any time. In the following experiment, mice were divided into three groups after an adjustment period of 7 days: the control group (N group, 12 wt/wt mice), the diabetic model group (M group, 12 db/db mice), and the probiotic-treated group (ML group, 12 db/db mice with the
The liver, kidney, and pancreas tissues were fixed in 4% (w/v) paraformaldehyde for 24 h, embedded in paraffin, and sectioned (5 μm). Sections were observed using an optical microscope (Motic China Group Co., Ltd., China). The sections were stained with hematoxylin and eosin (H&E), according to Zhao et al. (2021).
The colon tissues (100 mg) were homogenized in pre-cold RNA extraction solutions (1 ml), and centrifuged at 12,000 ×
Specific gene primers used for qRT-PCR.
Gene | Primers | Length (bp) |
---|---|---|
IL-6 | F: CCCCAATTTCCAATGCTCTCC |
141 |
IL-10 | F: TTTAAGGGTTACTTGGGTTGCC |
106 |
IL-1β | F: TCAAATCTCGCAGCAGCACATC |
206 |
GAPDH | F: CCTCGTCCCGTAGACAAAATG |
133 |
The liver tissue (100 mg) was homogenized in pre-chilled RIPA lysis buffer solution (1 ml), and centrifuged at 12,000 ×
The cecal contents (50 mg) were vortexed in methanol/water solution (1 : 1 v/v, 1 ml) and centrifuged at 12,000 ×
Data were analyzed with IBM® SPSS® 19.0 (IBM, USA) expressing as mean ± standard deviation. A one-way ANOVA was used to compare means. Statistical significance was determined by a
Twenty-three isolates were obtained from human feces samples and confirmed by 16S rDNA sequencing. The sequences of isolates were uploaded to the NCBI database, and the accession number of all isolates are listed in Table III. The similarity of each isolate is over 99%. Eighteen strains were
Identification of
Isolate number | Species | GenBank accession number | Similarity (%) |
---|---|---|---|
4 | MT482589 | 99.73 | |
5 | MT482590 | 99.93 | |
6 | MT482591 | 99.93 | |
8 | MT482586 | 99.93 | |
10 | MT482587 | 99.80 | |
11 | MT463724 | 99.93 | |
12 | MT482592 | 99.93 | |
13 | MT482593 | 99.93 | |
14 | MT482594 | 99.93 | |
16 | MT482595 | 99.93 | |
18 | MT482596 | 99.93 | |
20 | MT482588 | 99.93 | |
22 | MT463726 | 99.86 | |
25 | MT463727 | 99.86 | |
26 | MT482597 | 99.93 | |
27 | MT482598 | 99.93 | |
28 | MT482599 | 99.93 | |
29 | MT482600 | 99.93 | |
30 | MT482601 | 99.93 | |
33 | MT482602 | 99.93 | |
38 | MT482603 | 99.79 | |
39 | MT482604 | 99.86 | |
305 | MT463725 | 99.30 |
Inhibitory activities to α-amylase and α-glucosidase.
The inhibitory activities to α-amylase and α-glucosidase, and the viable count of the isolates.
Isolate | Viable bacteria count (109CFU/ml) | α-amylase inhibitory activities (%) | α-glucosidase inhibitory activities (%) | |
---|---|---|---|---|
8 | 1.71 ± 0.47ab | 49.93 ± 2.06c | 12.39 ± 3.05a | |
10 | 2.61 ± 0.38a | 56.72 ± 8.78ab | 12.60 ± 3.22a | |
20 | 2.29 ± 0.73ab | 17.33 ± 5.03d | 11.45 ± 4.18a | |
22 | 1.22 ± 0.47b | 62.29 ± 0.44a | 14.89 ± 0.38a | |
25 | 1.84 ± 0.70ab | 51.81 ± 3.65bc | 15.32 ± 0.89a | |
4 | 2.11 ± 0.64b | 20.96 ± 4.95f | 28.51 ± 5.73b | |
5 | 2.15 ± 0.25b | 16.84 ± 8.34f | 15.91 ± 0.91d | |
6 | 2.93 ± 0.28ab | 44.94 ± 3.72c | 19.33 ± 1.02cd | |
11 | 2.55 ± 0.30b | 58.40 ± 1.68a | 52.63 ± 3.07a | |
12 | 0.93 ± 0.66c | 44.05 ± 4.51c | 17.98 ± 9.09cd | |
13 | 2.85 ± 0.69ab | 51.86 ± 4.20b | 17.60 ± 1.84cd | |
14 | 2.96 ± 0.52ab | 37.19 ± 7.29d | 4.93 ± 0.94e | |
16 | 3.92 ± 0.38a | 32.29 ± 9.59de | 15.35 ± 8.28d | |
18 | 2.16 ± 0.80b | 27.35 ± 7.43e | 15.94 ± 1.38d | |
26 | 2.53 ± 0.98b | 49.95 ± 6.54bc | 15.60 ± 2.62d | |
27 | 2.49 ± 0.92b | 41.39 ± 2.52cd | 20.83 ± 4.58c | |
28 | 3.59 ± 0.50ab | 47.92 ± 3.62bc | 20.53 ± 0.17c | |
29 | 2.23 ± 0.67b | 46.74 ± 3.31bc | 4.99 ± 0.56e | |
30 | 2.41 ± 1.43b | 55.38 ± 0.48ab | 15.69 ± 1.93d | |
33 | 1.70 ± 0.90bc | 47.49 ± 2.27bc | 14.19 ± 2.13d | |
38 | 3.16 ± 0.77ab | 50.59 ± 3.12bc | 8.10 ± 4.18e | |
39 | 1.89 ± 0.59bc | 37.77 ± 8.18d | 5.24 ± 0.89e | |
305 | 2.04 ± 0.51bc | 57.48 ± 5.04ab | 51.79 ± 1.13e |
– means with different superscripts within the same row differ (
The survival rate of the four strains is shown in Table V. The survival rate of the strains after the simulated gastrointestinal digestion test were 12.42 ± 2.84%, 9.10 ± 1.12%, 5.86 ± 0.52%, and 8.82 ± 2.50%, respectively. The adhesion rates of
Simulated digestion test and adhesion rates.
Isolate | Survival rate (%) | Adhesion rate (%) |
---|---|---|
12.42 ± 2.84 | 6.94 ± 0.27 | |
9.10 ± 1.12 | 6.91 ± 0.11 | |
5.86 ± 0.52 | 6.09 ± 0.39 | |
8.82 ± 2.50 | 6.37 ± 0.28 |
Table VI shows that the optimal condition of α-amylase inhibitory activities was A1B1C1D1 (the optimal concentration of each strain in
Orthogonal test of the inhibitory activities to α-amylase of
Trial | A | B | C | D | Inhibitory activity (%) |
---|---|---|---|---|---|
1 | 1 | 1 | 3 | 2 | 70.00 |
2 | 1 | 2 | 1 | 1 | 82.50 |
3 | 1 | 3 | 2 | 3 | 38.00 |
4 | 2 | 1 | 2 | 1 | 71.50 |
5 | 2 | 2 | 3 | 3 | 7.50 |
6 | 2 | 3 | 1 | 2 | 31.00 |
7 | 3 | 1 | 1 | 3 | 43.00 |
8 | 3 | 2 | 2 | 2 | 30.00 |
9 | 3 | 3 | 3 | 1 | 25.50 |
K1 | 63.50 | 61.50 | 52.17 | 59.83 | |
K2 | 36.67 | 40.00 | 46.33 | 43.67 | |
K3 | 32.83 | 31.50 | 34.33 | 29.50 | |
30.67 | 30.00 | 17.84 | 30.33 | ||
Optimum technologies | A1B1C1D1 | 93.18 ± 1.19 | |||
SS | 0.334 | 0.294 | 0.096 | 0.279 | |
df | 2 | 2 | 2 | 2 | |
F | 10.969 | 9.637 | 3.156 | 9.143 | |
Significance | * | * | * |
– means significant factor
As was shown in Table VII, the inhibitory activities to α-glucosidase were most affected by
Orthogonal test of
Trial | A | B | C | D | Inhibitory activity (%) |
---|---|---|---|---|---|
1 | 1 | 1 | 3 | 2 | 73.57 |
2 | 1 | 2 | 1 | 1 | 63.28 |
3 | 1 | 3 | 2 | 3 | 54.32 |
4 | 2 | 1 | 2 | 1 | 71.93 |
5 | 2 | 2 | 3 | 3 | 35.05 |
6 | 2 | 3 | 1 | 2 | 62.74 |
7 | 3 | 1 | 1 | 3 | 64.79 |
8 | 3 | 2 | 2 | 2 | 24.18 |
9 | 3 | 3 | 3 | 1 | 54.39 |
K1 | 63.72 | 70.10 | 63.60 | 63.20 | |
K2 | 56.57 | 40.84 | 53.50 | 53.50 | |
K3 | 47.79 | 57.15 | 51.39 | 51.39 | |
15.94 | 29.26 | 12.22 | 11.81 | ||
Optimum technologies | A1B1C1D1 | 75.33 ± 2.89 | |||
SS | 0.076 | 0.258 | 0.057 | 0.048 | |
df | 2 | 2 | 2 | 2 | |
F | 74.785 | 252.387 | 55.709 | ||
Significance | * | * | * | * |
– means significant factor
The BW of the mice was significantly increased in the M and ML group compared with the N group in week 12, respectively (Fig. 1). Compared to the M group, the BW of the mice decreased slightly in the ML group in week 12. FBG was significantly increased in the M group compared with the N group in week 12. As compared to the M group, the FBG of the mice significantly decreased in the ML group in week 12. During the first four weeks of the treatment, the FBG of the mice in the M group increased and then remained at a higher level. Interestingly, the
Changes of body weight (a) and fasting blood glucose (FBG) levels (b) in mice. Significant differences exist between values with different letters (
N – Control group, wt/wt mice; M – model group, db/db mice; ML –
In the N group, the liver, kidney, pancreas, and colon structures were well-organized and showed no pathological signs. Compared to the N group, in the M group, the following was observed: 1) many vacuoles, irregularly arranged and disordered cells in the liver (Fig. 2a); 2) degeneration of glomerular and tubular structures and fat accumulation in the kidney (Fig. 2b); 3) islet atrophy and focal necrosis in the pancreas (Fig. 2c); and 4) a thinner intestinal wall, degeneration of structures and decreasion of cells (Fig. 2d). However, the
Morphological alterations in the liver (a), kidney (b), pancreas (c), and colon (d).
N – Control group, wt/wt mice; M – model group, db/db mice; ML –
As shown in Fig. 3, the mRNA expression levels of IL-6 and IL-1β were significantly increased. In contrast, the mRNA expression levels of IL-10 and ZO-1 were significantly decreased in the M group compared with the N group. There was a significant increase in the mRNA expression levels of IL-10 in the ML group compared to the M group, while the mRNA expression levels of IL-1β significantly decreased.
Colon inflammatory factor mRNA expression. Significant differences exist between values with different letters (
N – Control group, wt/wt mice; M – model group, db/db mice; ML –
The protein expression levels of PI3K and AKT in the liver are shown in Fig. 4. Compared with the N group, the protein expression levels of PI3K and AKT in the M group were significantly decreased. There was a significant increase in the protein expression levels of AKT in the ML group compared with the M group. In contrast, the protein expression levels of PI3K increased, but not significantly.
PI3K, AKT protein expression electropherogram, and protein relative expression. Significant differences exist between values with different letters (
N – Control group, wt/wt mice; M – model group, db/db mice; ML –
The contents of SCFAs in each group are shown in Fig. 5. Acetic acid, propionic acid, and butyric acid contents in the M group were significantly lower than in the N group. There was a significant increase in acetic acid and butyric acid contents in the ML group compared to the M group. however, no significant difference was detected in the contents of propionic acid between the M and ML group.
SCFAs content of mice in each group. Significant differences exist between values with different letters (
N – Control group, wt/wt mice; M – model group, db/db mice; ML –
Twenty-three isolates were obtained from the adult feces and identified as
It has been shown that the inhibition of α-amylase can reduce postprandial glucose levels (Saleem et al. 2018). In this study, a similar theory was applied to
Tolerance in the gastrointestinal tract is one of the probiotics’ most important features. The potential probiotics can tolerate the digestive tract environment to improve the physical condition of hosts (Salehizadeh et al. 2020). The survival rate of four of
Probiotics in the intestines have synergistic and complementary effects, so the benefits of mixed probiotic strains for humans are believed to be better than single strains (Al-Muzafar and Amin 2017). In this study, the orthogonal tests of the
The presence of hyperglycemia characterizes T2DM. It is crucial to control FBG levels in treating and preventing T2DM. The FBG level was significantly higher in the M group than in the N group in this research. The maximum FBG level in the M group was 33.11 ± 0.89 mmol/l. After 12 weeks of treatment, the FBG level was significantly reduced in the ML group compared with the M group. Similarly, Hsieh et al. (2020) reported that
The liver is critical for glucose and lipid metabolism. Diabetes can cause liver damage and destroy liver function (Abo El-Nasr et al. 2020). Morphological alterations in the liver verified the severity of liver damage in mice with T2DM, and the
Gut immunity and inflammation are crucial in metabolic diseases (Zhang et al. 2021). Vemuri et al. (2018) found that human-derived probiotics
The PI3K/AKT signaling pathway disorder is associated with high glucose concentrations, which is a critical cause of diabetes (Mohseni et al. 2021).
SCFAs are essential for supporting the structure and performance of epithelial cells (Liu et al. 2018). Meanwhile, SCFAs are beneficial for regulating glucose homeostasis and insulin secretion (Portincasa et al. 2022). Acetic acid can stimulate islet B cells, promote insulin secretion, adjust blood glucose and lipids, and maintain insulin sensitivity (Li et al. 2015). Butyric acid is metabolized by hindgut cells as a significant energy source and is transported to the liver for use in different biosynthetic pathways (Liu et al. 2018). Moreover, SCFAs can regulate the pH of the intestine to prevent harmful bacteria growth (Liu et al. 2018). Li et al. (2016) informed that
In conclusion, the