<abstract xmlns="http://www.w3.org/1999/xhtml">

<p>In this manuscript, we report the proteins macrophage infectivity potentiator (<italic>mip</italic>, CAB080), major outer membrane protein (<italic>momp</italic>, CAB048), and polymorphic outer membrane protein (<italic>pmp18D</italic>, CAB776) that are expressed in different times of pregnancy in mice infected with <italic>Chlamydia abortus</italic>. Enzootic abortion of ewes (EAE) by <italic>C. abortus</italic>, an obligate intracellular pathogen, is a critical zoonotic disease-causing significant economic loss to livestock farming globally. This study was carried out for the detection and characterization of macrophage infectivity potentiator (<italic>mip</italic>, CAB080), major outer membrane protein (<italic>momp</italic>, CAB048), and polymorphic outer membrane protein (<italic>pmp18D</italic>, CAB776) using RT-qPCR. These proteins are believed to be expressed as virulence factors in <italic>C</italic>. <italic>abortus</italic> isolated from aborted ewes. BALB/c mice (pregnant and nonpregnant) were used as an animal model to be injected intraperitoneally with <italic>C. abortus</italic> culture in Vero cells since the endometrial lymphoid tissues of these animals resembles that of ewes. Also, the short duration of pregnancy in mice makes them a suitable animal model for obstetric studies. Tissue samples were taken from the mice after 10, 15, and 20 days of pregnancy to compare the expression of the genes <italic>mip, pmp18D</italic>, and <italic>ompA</italic>. Transcription level was quantified using RT-qPCR, the GAPDH transcription quantification, as a normalization signal. Abortion occurred in pregnant mice, and apparent differences between the transcriptional levels of the <italic>mip, pmp18D</italic>, and <italic>ompA</italic> genes in the samples taken during different time intervals of pregnancy were not observed (<italic>p</italic> > 0.05). The result indicated that the three bacterial genes, <italic>mip</italic>, <italic>pmp18D</italic>, and <italic>ompA</italic>, play a role as virulence factors in abortion and are differentially expressed in pregnant and nonpregnant animals. Inactivation of the genes is suggested to confirm the hypothesis.</p>
</abstract>

In this manuscript, we report the proteins macrophage infectivity potentiator (mip, CAB080), major outer membrane protein (momp, CAB048), and polymorphic outer membrane protein (pmp18D, CAB776) that are expressed in different times of pregnancy in mice infected with Chlamydia abortus. Enzootic abortion of ewes (EAE) by C. abortus, an obligate intracellular pathogen, is a critical zoonotic disease-causing significant economic loss to livestock farming globally. This study was carried out for the detection and characterization of macrophage infectivity potentiator (mip, CAB080), major outer membrane protein (momp, CAB048), and polymorphic outer membrane protein (pmp18D, CAB776) using RT-qPCR. These proteins are believed to be expressed as virulence factors in C. abortus isolated from aborted ewes. BALB/c mice (pregnant and nonpregnant) were used as an animal model to be injected intraperitoneally with C. abortus culture in Vero cells since the endometrial lymphoid tissues of these animals resembles that of ewes. Also, the short duration of pregnancy in mice makes them a suitable animal model for obstetric studies. Tissue samples were taken from the mice after 10, 15, and 20 days of pregnancy to compare the expression of the genes mip, pmp18D, and ompA. Transcription level was quantified using RT-qPCR, the GAPDH transcription quantification, as a normalization signal. Abortion occurred in pregnant mice, and apparent differences between the transcriptional levels of the mip, pmp18D, and ompA genes in the samples taken during different time intervals of pregnancy were not observed (p > 0.05). The result indicated that the three bacterial genes, mip, pmp18D, and ompA, play a role as virulence factors in abortion and are differentially expressed in pregnant and nonpregnant animals. Inactivation of the genes is suggested to confirm the hypothesis.

Expression Level of the <italic>mip</italic>, <italic>pmp18D</italic>, and <italic>ompA</italic> Genes in <italic>Chlamydia abortus</italic> Isolated from Aborted Ewes

Department of Microbiology, College of Veterinary Medicine

Department of Basic Sciences, College of Veterinary Medicine

Polish Journal of Microbiology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Expression Level of the , , and  Genes in  Isolated from Aborted Ewes

In this manuscript, we report the proteins macrophage infectivity potentiator (mip, CAB080), major outer membrane protein (momp, CAB048), and polymorphic outer...

Target gene	Primer sequence (5′ to 3′)	Size (bp)
GAPDH	Forward: GGGGTCCCAGCTTAGGTTCAReverse: ACGGCCAAATCCGTTCACA	95
mip	Forward: AAGAAAACCTCTCCCTAGCCReverse: CTGAAGGTTTCCCTGATATTG	139
ompA	Forward: GCGGCATTCAACCTCGTTReverse: CCTTGAGTGATGCCTACATTGG	85
pmp18D	Forward: TCCACTGGGATGATCACCAATAReverse: GCATAGAAAGCGTATCGAGAATCAC	81

Group	Gene type	Period of pregnancy (days)	p-values
Pregnant group – nonpregnant	mip	101520	0.5930.6550.655
Pregnant group – nonpregnant	pmp18D	101520	0.1090.5930.593
Pregnant group – nonpregnant	ompA	101520	0.2851.0000.655

Expression Level of the mip, pmp18D, and ompA Genes in Chlamydia abortus Isolated from Aborted Ewes

Article Category: Original Paper

Publicado en línea: 30 mar 2022

Páginas: 115 - 121

Recibido: 04 nov 2021

Aceptado: 20 feb 2022

DOI: https://doi.org/10.33073/pjm-2022-014

Palabras clave
RT-qPCR, macrophage infectivity potentiator (), polymorphic membrane protein (), major outer membrane protein ()

© 2022 Eman Dhahir Arif et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1

Sequences of the forward and reverse primers of four genes used in Real-time PCR.

Wilcoxon signed-rank test analysis of the mip, pmp18D, and ompA genes expression between the pregnant groups in comparison to the nonpregnant groups at each time interval of pregnancy.

Expression Level of the mip, pmp18D, and ompA Genes in Chlamydia abortus Isolated from Aborted Ewes

Article Category: Original Paper

Publicado en línea: 30 mar 2022

Páginas: 115 - 121

Recibido: 04 nov 2021

Aceptado: 20 feb 2022

DOI: https://doi.org/10.33073/pjm-2022-014

Palabras claveRT-qPCR, macrophage infectivity potentiator (), polymorphic membrane protein (), major outer membrane protein ()

© 2022 Eman Dhahir Arif et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1

Sequences of the forward and reverse primers of four genes used in Real-time PCR.

Wilcoxon signed-rank test analysis of the mip, pmp18D, and ompA genes expression between the pregnant groups in comparison to the nonpregnant groups at each time interval of pregnancy.

Palabras clave
RT-qPCR, macrophage infectivity potentiator (), polymorphic membrane protein (), major outer membrane protein ()