Acceso abierto

The Characteristics and Function of Internalin G in Listeria monocytogenes

Huitian Gou
Huitian Gou
, 
Yuanyuan Liu
Yuanyuan Liu
, 
Wenjing Shi
Wenjing Shi
, 
Jinyu Nan
Jinyu Nan
, 
Chuan Wang
Chuan Wang
, 
Yanan Sun
Yanan Sun
, 
Qihang Cao
Qihang Cao
, 
Huilin Wei
Huilin Wei
, 
Chen Song
Chen Song
, 
Changqing Tian
Changqing Tian
, 
Yanquan Wei
Yanquan Wei
 y 
Huiwen Xue
Huiwen Xue
   | 30 mar 2022
Polish Journal of Microbiology's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Article Category: Original Paper
Publicado en línea: 30 mar 2022
Páginas: 63 - 71
Recibido: 22 nov 2021
Aceptado: 10 feb 2022
DOI: https://doi.org/10.33073/pjm-2022-009
Palabras clave
© 2022 Huitian Gou et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1

Analysis of the recombinant protein. M – Protein marker, 1 – bacteria before the induction with IPTG, 2 – the induced bacteria, 3 – supernatant of lysed induced bacteria, 4 – precipitation of induced bacteria, 5 – purified InlG recombinant protein, 6 – uninduced bacteria reaction with positive serum, 7 – induced bacteria reaction with positive serum.
Analysis of the recombinant protein. M – Protein marker, 1 – bacteria before the induction with IPTG, 2 – the induced bacteria, 3 – supernatant of lysed induced bacteria, 4 – precipitation of induced bacteria, 5 – purified InlG recombinant protein, 6 – uninduced bacteria reaction with positive serum, 7 – induced bacteria reaction with positive serum.

Fig. 2

Pathological changes in the tissue of infected mice stained with hematoxillin-eosin. a/d – Normal mouse, b/e – the mice immunized with normal saline, c/f – the mice immunized with protein and challenged with bacteria.
Pathological changes in the tissue of infected mice stained with hematoxillin-eosin. a/d – Normal mouse, b/e – the mice immunized with normal saline, c/f – the mice immunized with protein and challenged with bacteria.

Fig. 3

Relative adhesion and invasion of LM and LM-ΔInlG in Caco-2 cells. This test was done in triplicate in each run and repeated for three times. The cell assay rates of LM19111 were set at 100%. * p < 0.05; ** p < 0.01.
Relative adhesion and invasion of LM and LM-ΔInlG in Caco-2 cells. This test was done in triplicate in each run and repeated for three times. The cell assay rates of LM19111 were set at 100%. * p < 0.05; ** p < 0.01.

Fig. 4

Differentially expressed genes in LM-ΔInlG compared to LM. The abscissa indicates the fold change of gene expression, and the ordinate indicates the significance of the gene difference. The red dots indicate the up-regulated genes, the green dots indicate the down-regulated genes, and the blue dots indicate the genes that are not significantly different.
Differentially expressed genes in LM-ΔInlG compared to LM. The abscissa indicates the fold change of gene expression, and the ordinate indicates the significance of the gene difference. The red dots indicate the up-regulated genes, the green dots indicate the down-regulated genes, and the blue dots indicate the genes that are not significantly different.

Fig. 5

KEGG pathway analysis of differentially expressed genes in LM-ΔInlG compared to LM. The enriched KEGG categories are on the vertical axis. The ratio of the enriched DEGs in the KEGG category to the total genes in that category is shown on the horizontal axis.
KEGG pathway analysis of differentially expressed genes in LM-ΔInlG compared to LM. The enriched KEGG categories are on the vertical axis. The ratio of the enriched DEGs in the KEGG category to the total genes in that category is shown on the horizontal axis.

Differentially expressed genes in related KEGG pathways in LM-ΔInlG compared to LM.

Term Gene ID Name Log2FC Type Description
Quorum sensing lmo0205 plcB 1.89 up phospholipase C
lmo0202 hly 1.77 up listeriolysin O precursor
Novel00001 no 1.76 up thiol-activated cytolysin
Novel00002 no 1.64 up thiol-activated cytolysin beta sandwich domain
lmo2363 no –1.35 down glutamate decarboxylase
lmo0447 no 1.66 up pyridoxal-dependent decarboxylase conserved domain
Propanoate metabolism lmo1373 no –1.86 down transketolase, pyrimidine binding domain
lmo1153 no 1.88 up propanediol dehydratase subunit alpha
lmo2720 no –2.02 down AMP-binding enzyme C-terminal domain
lmo1374 no –1.52 down biotin-requiring enzyme
lmo1371 no –1.28 down pyridine nucleotide-disulphide oxidoreductase
Valine, leucine, nd isoleucine degradation lmo1373 no –1.86 down transketolase, pyrimidine binding domain
lmo1374 no –1.52 down biotin-requiring enzyme
lmo1371 no –1.28 down pyridine nucleotide-disulphide oxidoreductase
Glycerophospholipid metabolism lmo0205 plcB 1.89 up phospholipase C
lmo1176 eutC 3.18 up ethanolamine ammonia-lyase small subunit
lmo1175 eutB 1.87 up ethanolamine ammonia-lyase large subunit
Butanoate metabolism lmo1369 no –2.94 down phosphate acetyl/butaryl transferase
lmo2363 no –1.35 down glutamate decarboxylase
lmo0447 no 1.66 up pyridoxal-dependent decarboxylase conserved domain

PCR primers used in the experiments.

Primer Sequence Product (bp)
ΔInlG-F1 CGGGATCCGCTTATGATACAGTAGAAGAA (BamHI) 633
ΔInlG-R1 CCTCCGATGAAAAGCGTTCCTAAAATAGTAGGAATAATTCCCAAGATAGCTGTCACT
ΔInlG-F2 ATGTTTTACTTGTAGTGACAGCTATCTTGGGAATTATTCCTACTATTTTAGGAACGC 596
ΔInlG-R2 GCTCTAGAAGATAATTCAAGTTCTGTTA (XbaI)
D-F TGTCCGCAACAGCTAGCCCAG 1,644/3,100
D-R GCAAGTGGGGTTAAATCACTT
Hly-F GATGCATCTGCATTCAATAA 1,510
Hly-R TTATTCGATTGGATTATCTAC

Determination of the median lethal dose of the bacteria (BACT) in mice.

BACT (CFU) Death/Total Mortality (%)
109 9/10 90
108 8/10 80
107 6/10 60
106 4/10 40
105 2/10 20
0 0/10 0
eISSN:
2544-4646
Idioma:
Inglés
Calendario de la edición:
4 veces al año
Temas de la revista:
Life Sciences, Microbiology and Virology
RSS Feed de revista