Internalins are a protein family of LM. At present, there are 25 members, among which inlA and inlB are the earliest identified proteins related to bacterial invasion and are the main factors involved in bacterial invasion of host cells (Ireton et al. 2021). InlA mediates the internalization of LM through its interaction with the host-specific receptor E-cad, enabling LM to be endocytosed and enter the host epithelial cells (Drolia and Bhunia 2019). InlB can interact with multiple receptors on the surface of host cells to mediate LM adhesion and invasion of hepatocytes and nonphagocytes (Al-Obaidi and Desa 2018). Only some internalins play a role in mediating LM invasion (Gouin et al. 2019; Mir 2021). Balandyté et al. (2011) found that the inlG protein was mainly present in environmental isolates and rarely in strains isolated clinically from human and animal samples, suggesting that inlG is closely related to LM survival in the external environment. Jia et al. (2007) found that the
In the present study, inlG was expressed in a prokaryotic system. After immunizing mice with the expressed product, its protection was evaluated. An
The reference strain of LM ATCC®19111 (1/2a) and human colorectal adenocarcinoma (Caco-2) cells were purchased from the China Culture Collection Center.
PCR primers used in the experiments.
Primer | Sequence | Product (bp) |
---|---|---|
ΔInlG-F1 | 633 | |
ΔInlG-R1 | CCTCCGATGAAAAGCGTTCCTAAAATAGTAGGAATAATTCCCAAGATAGCTGTCACT | |
ΔInlG-F2 | ATGTTTTACTTGTAGTGACAGCTATCTTGGGAATTATTCCTACTATTTTAGGAACGC | 596 |
ΔInlG-R2 | ||
D-F | TGTCCGCAACAGCTAGCCCAG | 1,644/3,100 |
D-R | GCAAGTGGGGTTAAATCACTT | |
Hly-F | GATGCATCTGCATTCAATAA | 1,510 |
Hly-R | TTATTCGATTGGATTATCTAC |
To grow LM ATCC®19111 strains, overnight cultures were diluted 100-fold in Brain Heart Infusion medium (BHI, China) and shaken at 37°C. The recombinant plasmid pET-28a (+)-InlG was constructed, which was transformed into the expression strain BL21 (DE3). We carried out IPTG induction to positive recombinant plasmid pET-28a (+)-InlG and optimization of the expression conditions, SDS-PAGE analysis of the expression product size, and western blotting to verify the antigenicity of the expressed protein.
Thirty-two 7-week-old male BALB/c mice were obtained from the Experimental Animal Center of the Chinese Academy Agricultural of Sciences (Lanzhou, China) and maintained in cages with food and water ad libitum. They were divided into two groups of 16 mice, respectively. Groups were immunized with 100 pg of recombinant inlG mixed with complete Freund’s adjuvant (Sigma, USA) for priming and incomplete Freund’s adjuvant (Sigma, USA) for boosting. Immunizations were carried out on days 1, 15, and 30. Blood was collected by tail vein bleeding before immunization. The antibody titer was measured after each immunization by indirect ELISA. When the titer increased more than 1:52,000, mice were intraperitoneally infected with LM at twice LD50, and the immunoprotective effect of
Mice in the three groups (unchallenged, unimmunized-challenged, and immunized-challenged) (n = 3, respectively) were dissected after death, and brain and liver tissues were removed and prepared in paraffin sections. After hematoxylin-eosin staining, pathological changes were observed under an optical microscope (Olympus, Japan).
The primers were designed to amplify the upstream and downstream homologous arms of the
The growth of wild-type LM and LM-inlG was evaluated by measuring OD600 at 30°C, 37°C, and 41°C and pH 5, 7, and 9. The adhesion and invasion rates of the two strains were calculated as described previously (Medeiros et al. 2021; Pereira et al. 2021). Human colon carcinoma cells (Caco-2) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, China) with high glucose, supplemented with10% fetal bovine serum (FBS) (Gibco, China). They were then seeded in 12-well plates at a density of 1 × 105 cells/well and incubated at 37°C in the presence of 5% CO2. For the adhesion assay, overnight (18 h)-grown bacterial cultures were washed thrice with PBS, adjusted to OD600 = 0.12, and suspended in DMEM to a final concentration of 1 × 108 CFU/ml. The Caco-2 cell monolayer was washed three times using DMEM, then exposed separately to the LM and LM-
Total RNA was extracted from LM and LM-AinlG samples using the RNAprep Pure Kit (Tiangen, China), following the manufacturer’s instructions. In total, 5 pg RNA/sample was sent to Beijing Novogene Technology Co., Ltd., China for RNA sequencing. According to the instructions, the Library Prep Kit (Tiangen, China) was used to construct the chain-specific library for RNA samples. The library was sequenced using the Illumina sequencing platform (HiSeq 4000). Raw data (raw reads) of FASTQ format were firstly processed through in-house Perl scripts. The LM reference genome (NC_003210) and associated gene annotation information were downloaded from the NCBI database. The sequence alignment software, Bowtie2 (2.3.4.3) was used for genome location analysis of clean reads.
The number of gene counts per sample was standardized using DEGSeq2 (1.20) software. We then performed hypothesis testing and set the threshold as |log2 Fold Chang e| > 1,
The molecular weight of the inlG protein was estimated to be 53 ku, but the size of the inlG protein was about 70 ku according to SDS-PAGE. Therefore, the expressed protein was identified by mass spectrometry. The mass spectrometry results matched the LM reference sequence to the highest degree, and the protein was confirmed to be an expression product of the
Analysis of the recombinant protein. M – Protein marker, 1 – bacteria before the induction with IPTG, 2 – the induced bacteria, 3 – supernatant of lysed induced bacteria, 4 – precipitation of induced bacteria, 5 – purified
The mortality of mice infected with LM is shown in Table II and was calculated according to the formula: logLD50 = [Xm-i (XP-0.5)]. Finally, the LD50 of LM was 1.0 × 106.6 CFU. The antibody titer of inlG was more than 1:52,000 in mice by indirect ELISA. After intraperitoneal infection of mice with LM, the control group had rough hair and were huddled and listless. Individual mice gradually developed tremors, increased secretion at the canthus, and accelerated respiratory rate. Fifteen mice died within 72 h, and one survived. However, eight mice in the test group developed similar symptoms and died. The remaining eight mice became normal at 48 h after the challenge (Table II).
Determination of the median lethal dose of the bacteria (BACT) in mice.
BACT (CFU) | Death/Total | Mortality (%) |
---|---|---|
109 | 9/10 | 90 |
108 | 8/10 | 80 |
107 | 6/10 | 60 |
106 | 4/10 | 40 |
105 | 2/10 | 20 |
0 | 0/10 | 0 |
Compared with the brain tissue of the normal group (Fig. 2a), the challenge group after immunization with saline was filled with red blood cells, and a large number of lymphocytes were infiltrated in the pons (Fig. 2b). After protein immunization, the interface between the cortex and medulla in the brain tissue of mice in the challenge group was clear, and there were fissure vacuoles in the medulla (Fig. 2c). Brain tissue damage in the immunoprotein group post-challenge was milder than that in the normal saline group.
Pathological changes in the tissue of infected mice stained with hematoxillin-eosin. a/d – Normal mouse, b/e – the mice immunized with normal saline, c/f – the mice immunized with protein and challenged with bacteria.
Compared with liver tissue in the normal group (Fig. 2d), mice in the challenge group after immunization with saline (Fig. 2e) suffered a severe liver injury, irregular arrangement of hepatic lobules, and dilated central veins. The hepatic cord of mice in the challenge group disappeared after protein immunization (Fig. 2f). As in the brain, liver injury in the protein challenge group was milder than in the normal saline challenge group.
The amplified upstream and downstream homologous arms of
There was no significant difference in growth characteristics and biochemical and hemolysis test results between wild-type LM and LM-AinlG. The LD50 of the deleted strain LM was 1.0 × 106.9 CFU, and the wild strain LM was 1.0 × 106.6 CFU. The adhesion rate of LM-AinlG to Caco-2 cells was 1.3 times higher than the wild-type strain, and the invasion rate was about 2.45 times higher than the wild-type strain (Fig. 3).
Relative adhesion and invasion of LM and LM-ΔInlG in Caco-2 cells. This test was done in triplicate in each run and repeated for three times. The cell assay rates of LM19111 were set at 100%. *
The transcribed genes were classified into gene ontology (GO) categories: 45 genes were classified into biological processes, 19 to cellular components, and 29 to molecular functions. Compared to the wild strain, 18 genes were up-regulated and 24 genes were down-regulated in the LM-AinlG (Fig. 4). The DEGs were compared with the Kyoto Encyclopedia of Genes and Genomes (KEGG,
Differentially expressed genes in LM-ΔInlG compared to LM. The abscissa indicates the fold change of gene expression, and the ordinate indicates the significance of the gene difference. The red dots indicate the up-regulated genes, the green dots indicate the down-regulated genes, and the blue dots indicate the genes that are not significantly different.
KEGG pathway analysis of differentially expressed genes in LM-ΔInlG compared to LM. The enriched KEGG categories are on the vertical axis. The ratio of the enriched DEGs in the KEGG category to the total genes in that category is shown on the horizontal axis.
Differentially expressed genes in related KEGG pathways in LM-ΔInlG compared to LM.
Term | Gene ID | Name | Log2FC | Type | Description |
---|---|---|---|---|---|
Quorum sensing | lmo0205 | plcB | 1.89 | up | phospholipase C |
lmo0202 | hly | 1.77 | up | listeriolysin O precursor | |
Novel00001 | no | 1.76 | up | thiol-activated cytolysin | |
Novel00002 | no | 1.64 | up | thiol-activated cytolysin beta sandwich domain | |
lmo2363 | no | –1.35 | down | glutamate decarboxylase | |
lmo0447 | no | 1.66 | up | pyridoxal-dependent decarboxylase conserved domain | |
Propanoate metabolism | lmo1373 | no | –1.86 | down | transketolase, pyrimidine binding domain |
lmo1153 | no | 1.88 | up | propanediol dehydratase subunit alpha | |
lmo2720 | no | –2.02 | down | AMP-binding enzyme C-terminal domain | |
lmo1374 | no | –1.52 | down | biotin-requiring enzyme | |
lmo1371 | no | –1.28 | down | pyridine nucleotide-disulphide oxidoreductase | |
Valine, leucine, nd isoleucine degradation | lmo1373 | no | –1.86 | down | transketolase, pyrimidine binding domain |
lmo1374 | no | –1.52 | down | biotin-requiring enzyme | |
lmo1371 | no | –1.28 | down | pyridine nucleotide-disulphide oxidoreductase | |
Glycerophospholipid metabolism | lmo0205 | plcB | 1.89 | up | phospholipase C |
lmo1176 | eutC | 3.18 | up | ethanolamine ammonia-lyase small subunit | |
lmo1175 | eutB | 1.87 | up | ethanolamine ammonia-lyase large subunit | |
Butanoate metabolism | lmo1369 | no | –2.94 | down | phosphate acetyl/butaryl transferase |
lmo2363 | no | –1.35 | down | glutamate decarboxylase | |
lmo0447 | no | 1.66 | up | pyridoxal-dependent decarboxylase conserved domain |
The
In the mouse protective test, the mortality was 93.75% in the control group and 50% in the experimental group, indicating that inlG protein conferred some antigenic protection after immunization. The cause of death of mice in the experimental group was analyzed. The LM used in this study was the highly pathogenic 1/2a serotype. Studies have reported that > 98% of listeriosis is caused by serotype 1/2b, 4b, and 1/2a strains, and serotype 1/2a is the dominant strain in China (Chen et al. 2020; Liu et al. 2020). In addition, it may be related to the weak protection of mice immunized with inlG protein. Bu et al. (2017) found that the protection of recombinant fusion antigen was better than that of a single protein in mice challenged with LM. Therefore, the genes with dominant epitopes in the internalin family can be expressed in the future to study whether they have good antigenicity.
The internalins are closely related to LM virulence and are unique to LM for adhesion and invasion of host cells. In this study,
From the transcriptomics result of LM-AinlG compared to LM, the expression level of LLO, PlcB, ActA, and InlC were up-regulated. So, this result explains why the adhesion to and invasion of Caco-2 cells were enhanced for LM-AinlG. KEGG annotation results indicated that quorum sensing, propanoate metabolism, valine, leucine, and isoleucine degradation, glycerophospholipid metabolism, and butanoate metabolism are significant pathways from LM-AinlG compared to LM. The quorum sensing (QS) pathway refers to the ability of bacteria to secrete signal molecules to the outside world continuously. By detecting the concentration of signal molecules, we can sense the population density of bacteria. QS regulates many biological characteristics, such as motility, biofilm formation, colonization, adhesion, virulence factor secretion, and bioluminescence, which are necessary for the survival or virulence of many bacteria (Younis et al. 2016). Amino acid metabolism, such as valine, leucine, and isoleucine metabolism, is likely critical for protein synthesis. However, the study also demonstrated that valine, leucine, and isoleucine degradation might be related to cell adhesion (Chandrashekar et al. 2020). Enrichment of propanoate metabolism may affect energy metabolism. These KEGG pathways were also observed in other bacteria and human cells, suggesting that propanoate may control the activity or stability of enzymes involved in pathways and affect energy metabolism regulation (Yi and Xie 2021).
This study evaluated the potential of inlG as a vaccine candidate to protect against LM infection. In addition, by constructing the gene deleted strain, it was verified that inlG was related to the virulence of LM. We also clarified the mechanism of LM-AinlG from the transcriptomics analysis. The next step will be to explore the detailed functional mechanism of inlG by analyzing the receptor for