Cite

Figure 1.

(A) Sampling location of adult stable flies (Stomoxys calcitrans). (B—F) Larval form of the mermithid nematode from Gifu. (B) Whole body. (C, D) Anterior part and its extremity. (E, F) Posterior part and its extremity with a tail appendage (arrowhead).
(A) Sampling location of adult stable flies (Stomoxys calcitrans). (B—F) Larval form of the mermithid nematode from Gifu. (B) Whole body. (C, D) Anterior part and its extremity. (E, F) Posterior part and its extremity with a tail appendage (arrowhead).

Figure 2.

Phylogenetic trees of Mermithidae with known genus-level identifications based on 18S (A) and 28S (B) rDNA using the maximum-likelihood method. Arrowheads indicate the mermithids sequenced in this study. Bootstrap values above 50% are indicated at the phylogenetic tree node.
Phylogenetic trees of Mermithidae with known genus-level identifications based on 18S (A) and 28S (B) rDNA using the maximum-likelihood method. Arrowheads indicate the mermithids sequenced in this study. Bootstrap values above 50% are indicated at the phylogenetic tree node.

Figure 3.

Phylogenetic tree of Mermithidae with known hosts based on 18S rDNA sequences using the maximum-likelihood method. Arrowheads indicate the mermithids sequenced in this study. The red frame includes mermithids recorded from Japan. Bootstrap values above 65% are indicated at the phylogenetic tree node.
Phylogenetic tree of Mermithidae with known hosts based on 18S rDNA sequences using the maximum-likelihood method. Arrowheads indicate the mermithids sequenced in this study. The red frame includes mermithids recorded from Japan. Bootstrap values above 65% are indicated at the phylogenetic tree node.

Figure 4.

Phylogenetic tree of unidentified species of mermithid nematodes parasitizing insects in Japan based on 18S rDNA sequences (A) using the maximum-likelihood method and (B) distribution map of mermithids included in Ovomermis sinensis, Hexamermis sp., and Amphimermis sp. clusters. Ovomermis sinensis (KU177046), Hexamermis agrotis (DQ530350), Hexamermis popilliae (MF040823), Romanomerimis sichuanensis (EF612769), and Amphimermis enzoni (MT021436) have been identified in other countries and used as reference species in the phylogenetic tree. Arrowheads indicate the mermithids isolated in Gifu and sequenced in this study. Bootstrap values above 65% are indicated at the phylogenetic tree node.
Phylogenetic tree of unidentified species of mermithid nematodes parasitizing insects in Japan based on 18S rDNA sequences (A) using the maximum-likelihood method and (B) distribution map of mermithids included in Ovomermis sinensis, Hexamermis sp., and Amphimermis sp. clusters. Ovomermis sinensis (KU177046), Hexamermis agrotis (DQ530350), Hexamermis popilliae (MF040823), Romanomerimis sichuanensis (EF612769), and Amphimermis enzoni (MT021436) have been identified in other countries and used as reference species in the phylogenetic tree. Arrowheads indicate the mermithids isolated in Gifu and sequenced in this study. Bootstrap values above 65% are indicated at the phylogenetic tree node.

Primers and PCR conditions used in this study.

Target Primers Sequence (5′-3′) PCR conditions
Reference
Denaturation Annealing Extension Cycles
18S rDNA MF CAAGGACGAAAGTTAGAGGTTC 95°C, 30sec 50°C, 30sec 72°C, 45sec 40 Kobylinski et al. 2012
MR GGAAACCTTGTTACGACTTTTA
KuboF ATGCATGTCTAAGCACATGCC 95°C, 30sec 50°C, 1min 72°C, 2min 40 Kubo et al. 2016
KuboR AACCTTGTTACGACTTTTACTTC
newF AGTTATCTACTTGGATAACTGTG This study
28S rDNA F (3745-3764) AGCGGAGGAAAAGAAACTAA 95°C, 30sec 62°C, 30sec 72°C, 1min 35 Nadler et al. 1998
R (4359-4377) ATCCGTGTTTCAAGACGGG
LSU-F ACAAGTACCGTGAGGGAAAGTTG 94°C, 30sec 45°C, 1min 72°C, 2min 40 Tong et al. 2021
LSU-R TCGGAAGGAACCAGCTACTA

Mermithid nematodes reported in Japan.

Species Location Host Reference
Agamermis unka Hiroshima Sogatella furcifera Nilaparvata lugens (Homoptera: Delphacidae) Hidaka and Andow, 2017
Amphimermis zuimushi Shizuoka Chilo simplex Butler (Lepidoptera: Pyralidae) Kaburaki and Imamura, 1932
Gastromermis mesostoma lsomermis bipapillatus Fukuoka, Kagoshima, Oita Simulium japonicum (Diptera: Simuliidae) Poinar et al., 1986
Hexamermis sp. Mermithidae sp. Mie, Saga, Shizuoka Glaucias subpunctatus Plautia stali (Hemiptera: Parastrachiidae, Pentatomidae) Watanabe et al., 2021
Mermithidae sp. Hokkaido Bombus pseudobaicalensis Vogt (Hymenoptera: Bombinae) Kubo et al., 2016
Mermithidae sp. Kanagawa Ligidium sp. (Isopoda: Ligiidae) Yoshino and Waki, 2021
Mermithidae sp. Hokkaido Eriosoma auratum (Hemiptera: Aphididae) Tong et al., 2021
Mermithidae sp. Saga, Nagasaki, Kagoshima Parastrachia japonensis Plautia stali (Hemiptera: Parastrachiidae, Pentatomidae) Iryu et al., 2020
Mermithidae sp. Kyoto Pardosa pseudoannulata (Araneae: Lycosidae) Iida et al., 2003

Mermithid nematodes used in phylogenetic analysis of 18S and 28S rDNA retrieved from GenBanka.

Organism Location Host Accession number Reference
18S rDNA 28S rDNA
Agamermis changshaensis - - DQ628908 - Unpublished
Agamermis changshaensis - - - EF617371 Unpublished
Agamermis xianyangensis - - EF617352 EF617370 Unpublished
Agamermis sp. Argentina United States Armadillidium vulgare (Isopoda: Armadillidiidae) OP380610 - Unpublished
Megacopta cribraria (Hemiptera: Plataspidae) KX173336 - Stubbins et al. 2016
- Environment DQ665653 - Unpublished
Allomermis solenopsii - - DQ533953 - Unpublished
Amphimermis enzoni Argentina Ischnura fluviatilis Rhionaeschna bonaerensis (Odnata) MT021436 - Rusconi et al. 2020
Amphimermis sp. China - EF617354 EF617372 Unpublished
- EF617355 EF617373
Gastromermis sp. - - DQ533954 - Unpublished
- - AY146543 - Unpublished
Gastromermis viridis Canada Simulium squamosum (Diptera: Simuliidae) EU792502 - St-Onge et al. 2008
Heleidomermis sp. - - DQ533955 - Unpublished
Hexamermis agrotis - - DQ530350 - Unpublished
- - - EF617369 Unpublished
Turkey - - KC784667 Unpublished
Hexamermis popilliae Italy Popillia japonica (Coleoptera: Scarabaeidae) MF040823 MF040824 Mazza et al. 2017
- MF040826
Hexamermis sp. Japan Glaucias subpunctatus (Hemiptera: Pentatomidae) LC661690 - Watanabe et al. 2021
LC661691 -
Isomermis lairdi Ghana Simulium squamosum (Diptera: Simuliidae) FN400899 - Crainey et al. 2009
FN400892 -
Limnomermis sp. - - KJ636371 - Unpublished
Mermis nigrescens Viet Nam Orthomorpha coarctata (Polydesmida: Paradoxosomatidae) OQ341432 - Unpublished
New Forficula auricularia (Dermaptera: Forficulidae) KF583882 KF886019 Unpublished
Zealand Plant KF583883 KF886018
- - AF036641 - Blaxter et al. 1998
Mermithidae sp. Japan Parastrachia japonensis (Hemiptera: Parastrachiidae) LC512368 - Iryu et al. 2020
LC512369 -
LC512370 -
LC512371 -
Japan Plautia stali (Hemiptera: Parastrachiidae) LC512372 - Iryu et al. 2020
Japan Ligidium sp. (Isopoda: Ligiidae) LC596451 LC500234 Yoshino and Waki, 2021
LC596452 LC500235
Japan Eriosoma auratum (Hemiptera: Aphididae) MW649131 MW653323 Tong et al. 2021
Japan Bombus pseudobaicalensis (Hymenoptera: Apidae) LC114020 - Kubo et al. 2016
Japan Glaucias subpunctatus (Hemiptera: Pentatomidae) LC661692 - Watanabe et al. 2021
Japan Plautia stali (Hemiptera: Parastrachiidae) LC661693 - Watanabe et al. 2021
Japan Stomoxys calcitrans (Diptera: Muscidae) LC788412 LC788415 This study
LC788413 LC788416
LC788414 LC788417
Australia Kosciscola tristis (Orthoptera: Acrididae) JQ894731 - Umbers et al. 2015
JQ894732 -
Mesomermis camdenensis Canada Simulium squamosum (Diptera: Simuliidae) EU792504 - St-Onge et al. 2008
Mesomermis flumenalis Canada Simulium squamosum (Diptera: Simuliidae) EU792506 - St-Onge et al. 2008
Octomyomermis huazhongensis - - EF617353 EF617368 Unpublished
Ovomermis sinensis China Spodoptera frugiperda (Lepidoptera: Noctuidae) MN367957 MN367955 Sun et al. 2020
MN367956 MN367954
Poland Cerapteryx graminis (Lepidoptera: Noctuidae) KU177046 - Unpublished
- - DQ520879 - Unpublished
Pheromermis sp. France Vespa velutina (Hymenoptera: Vespidae) KR029620 KR029622 Villemant et al. 2015
KR029621 KR029623
Romanomermis culicivorax - Culex sp. (Diptera: Culicidae) DQ418791 - Unpublished
- - - EF417153 Sonnenberg et al. 2007
Romanomermis iyengari - - JX021620 - Unpublished
Romanomermis sichuanensis - Culex sp. (Diptera: Culicidae) EF612769 EF617366 Unpublished
Romanomermis wuchangensis - Culex quinquefasciatus (Diptera: Culicidae) DQ520878 EF617365 Unpublished
Strelkovimermis spiculatus Argentina Aedes albifasciatus (Diptera: Culicidae) KP270703 - Belaich et al. 2015
- Aedes sp. (Diptera: Culicidae) DQ665654 - Unpublished
Thaumamermis cosgrovei - - DQ665655 - Unpublished
Thaumamermis zealandica New Zealand Bellorchestia quoyana (Amphipoda: Talitridae) KY264164 KY264165 Unpublished

Detection of parasitic nematodes from Stomoxys calcitrans on three farms in the Gifu Prefecture, Japan.

Farm Location Sampling date Total stable flies (Number) Parasitized stable flies (Number) Total nematodes (Number)
Dairy cattle farm
F1 Gifu 11 Oct 2021 80 1 1a
15 Sep 2022 140 0 0
20 Sep 2023 112 0 0
Subtotal 332 1 1
F2 Yourou 8 Oct 2021 17 1 1b
18 Oct 2022 38 0 0
11 Oct 2023 27 0 0
Subtotal 82 1 1

Sheep farm
F3 Nakatsugawa 29 Jul 2022 72 1 1c
Total 486 3 3

Information on locations of nematode species and hosts corresponding to nematodes used in Figure 4a.

Species Accession number Location in Japan
Host
Reference
(Country) Family Genus Species
Ovomermis / Hexamermis cluster
Ovomermis sinensis KU177046 (Poland) Noctuidae Cerapteryx C. graminis Unpublished
Hexamermis sp. LC661690 Mie Pentatomidae Glaucias G. subpunctatus Watanabe et al., 2021
LC661691 Mie Pentatomidae Glaucias G. subpunctatus Watanabe et al., 2021
Mermithidae sp. LC788413 Gifu Muscidae Stomoxys S. calcitrans This study
LC788412 Gifu Muscidae Stomoxys S. calcitrans This study
LC512368 Saga Parastrachiidae Parastrachia P. japonensis Iryu et al., 2020
LC512372 Saga Parastrachiidae Parastrachia P. japonensis Iryu et al., 2020
LC661692 Shizuoka Pentatomidae Glaucias G. subpunctatus Watanabe et al., 2021
LC114020 Hokkaido Apidae Bombus B. pesudobaicalensis Kubo et al., 2016
LC661693 Mie Pentatomidae Plautia P. stali Watanabe et al., 2021
LC596451 Kanagawa Ligiidae Ligidium sp. Yoshino and Waki, 2021
LC596452 Kanagawa Ligiidae Ligidium sp. Yoshino and Waki, 2021
Hexamermis agrotis DQ530350 (China) - - - Unpublished
Hexamermis popilliae MF040823 (Italy) Scarabaeidae Popillia P. japonica Mazza et al., 2017

Amphimermis cluster
Amphimermis enzoni MT021436 (Argentina) Coenagrionidae Ischnura I. fluviatilis Rusconi et al., 2020
Aeshnidae Rhionaeschna R. bonariensis
Mermithidae sp. LC788414 Gifu Muscidae Stomoxys S. calcitrans This study
LC512369 Saga Parastrachiidae Parastrachia P. japonensis Iryu et al., 2020
LC512371 Kagoshima Parastrachiidae Parastrachia P. japonensis Iryu et al., 2020
LC512370 Kagoshima Parastrachiidae Parastrachia P. japonensis Iryu et al., 2020

Others
Mermithidae sp. MW649131 Hokkaido Aphididae Eriosoma E. auratum Tong et al., 2021
Romanomermis sichuanensis EF612769 (China) - - - Unpublished
eISSN:
2640-396X
Idioma:
Inglés
Calendario de la edición:
Volume Open
Temas de la revista:
Life Sciences, other