Acceso abierto

Down-regulation of neuronal form of Nitric oxide synthase in the Nurse cell of Trichinella spiralis


Cite

Fig. 1.

Immunohistochemistry. Modified methacarn fixed sections from mouse skeletal muscles with Trichinella spiralis at days 14, 24, and 35 post invasion (d.p.i.) were stained with polyclonal rabbit anti-nNOS/NOS Type 1 antibody. Parallel sections were subjected to H&E staining to facilitate the histological orientation. The brown colour indicates a positive immunohistochemical reaction, hashtag indicates the occupied sarcoplasma, star – non-occupied skeletal muscle fibre, arrow – enlarged nucleus, L – larva. H&E, anti-mouse peroxidase conjugate, DAB. Obj. magn. – 20x, scale bar 20 μm.
Immunohistochemistry. Modified methacarn fixed sections from mouse skeletal muscles with Trichinella spiralis at days 14, 24, and 35 post invasion (d.p.i.) were stained with polyclonal rabbit anti-nNOS/NOS Type 1 antibody. Parallel sections were subjected to H&E staining to facilitate the histological orientation. The brown colour indicates a positive immunohistochemical reaction, hashtag indicates the occupied sarcoplasma, star – non-occupied skeletal muscle fibre, arrow – enlarged nucleus, L – larva. H&E, anti-mouse peroxidase conjugate, DAB. Obj. magn. – 20x, scale bar 20 μm.

Fig. 2.

Agarose gel analysis of Trichinella spiralis ESV fragment PCR. Polymerase chain reaction was performed on modified methacarn fixed mouse skeletal muscle tissue sections, selected on days 0, 14, 24, and 35 after T. spiralis invasion. Genomic DNA from T. spiralis infectious larvae was used as a positive control sample. Presence of 173 bp fragment of expansion segment V of the T. spiralis genome was detected only in the mouse samples collected on days 14, 24 and 35 after the invasion. The photograph is representative of three randomly selected samples from each experimental group.
Agarose gel analysis of Trichinella spiralis ESV fragment PCR. Polymerase chain reaction was performed on modified methacarn fixed mouse skeletal muscle tissue sections, selected on days 0, 14, 24, and 35 after T. spiralis invasion. Genomic DNA from T. spiralis infectious larvae was used as a positive control sample. Presence of 173 bp fragment of expansion segment V of the T. spiralis genome was detected only in the mouse samples collected on days 14, 24 and 35 after the invasion. The photograph is representative of three randomly selected samples from each experimental group.

Fig. 3.

Expression of mouse Nitric oxide synthase 1 (Nos1) analysed by realtime RT-PCR in modified methacarn fixed mouse skeletal muscle tissue sections, selected on days 0, 14, 24, and 35 after T. spiralis invasion. The graphs show the relative quantification of the gene expressions calculated by the ΔΔCt method versus glyceraldehyde phosphate dehydrogenase (Gapdh) as a reference gene from five individual samples in triplicate. The bars show the standard error of the mean. The products of amplification were loaded on 2.5% agarose gel versus Perfect 100–1000 bp DNA Ladder.
Expression of mouse Nitric oxide synthase 1 (Nos1) analysed by realtime RT-PCR in modified methacarn fixed mouse skeletal muscle tissue sections, selected on days 0, 14, 24, and 35 after T. spiralis invasion. The graphs show the relative quantification of the gene expressions calculated by the ΔΔCt method versus glyceraldehyde phosphate dehydrogenase (Gapdh) as a reference gene from five individual samples in triplicate. The bars show the standard error of the mean. The products of amplification were loaded on 2.5% agarose gel versus Perfect 100–1000 bp DNA Ladder.

The full names of the investigated genes and their primers sequences used in this study.

Gene Abbreviation Species Accession number Primers sequences (5‘-3‘) Product size (bp)
Glyceraldehyde 3-phosphate dehydrogenase Gapdh Mus musculus NM_001289726, transcript variant 1 TCCTCGTCCCGTAGACAAAATG – F 103
AATCTCCACTTTGCCACTGC – R
Nitric oxide synthase 1 Nos1 Mus musculus NM_008712.3 CCAGCCAAAGCAGAGATGAAAG – F 121
TCCCCCACAGATCATTGAAGAC – R
Expansion segment V ESV Trichinella spiralis * GTTCCATGTGAACAGCAGT – F 173
CGAAAACATACGACAACTGC – R
eISSN:
1336-9083
Idioma:
Inglés
Calendario de la edición:
4 veces al año
Temas de la revista:
Life Sciences, Zoology, Ecology, other, Medicine, Clinical Medicine, Microbiology, Virology and Infection Epidemiology