New in vitro findings about halogenated boroxine cytotoxicity and deregulation of cell death-related genes in GR-M melanoma cells
04 abr 2023
Acerca de este artículo
Categoría del artículo: Original article
Publicado en línea: 04 abr 2023
Páginas: 16 - 21
Recibido: 01 dic 2022
Aceptado: 01 feb 2023
DOI: https://doi.org/10.2478/aiht-2023-74-3702
Palabras clave
© 2023 Nikolina Elez-Burnjaković et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.








Figure 1

Primer sequences used for selected cell death-related genes
Gene | Reference sequence No. (FASTA format) | Primers |
---|---|---|
NM_003766.5 | Forward: CTCCCGAGGTGAAGAGCATC |
|
NM_003900.5 | Forward: CCGTGAAGGCCTACCTTCTG |
|
NM_000633.3 | Forward: GGGGTCATGTGTGTGGAGAG |
|
NM_018370.3 | Forward: TTGGTGCAGCCACGATGTAT |
Changes in relative BCL-2 gene expression after GR-M and PBM cell treatment with halogenated boroxine compared to negative control
HB concentrations (mg/mL) | GR-M cells | PBM cells | ||
---|---|---|---|---|
|
Fold change/P value |
|
Fold change/P value | |
down | -3.805/0.672 | up | 2.04/ |
|
up | 11.769/ |
down | -1.158/0.677 | |
up | 1.568/ |
up | 2.14/ |
|
down | -10.933/ |
down | -1.262/0.169 | |
down | -1.041/0.848 | up | 6.365/ |
Changes in relative DRAM1 gene expression after GR-M and PBM cell treatment with halogenated boroxine compared to negative control
HB concentrations (mg/mL) | GR-M cells | PBM cells | ||
---|---|---|---|---|
|
Fold change/P value |
|
Fold change/P value | |
down | 1.661/0.3405 | up | 15.778/0.667 | |
down | 1.098/0.671 | up | 459.792/ |
|
down | 1.209/0.828 | up | 7968.193/ |
|
down | 4.195/ |
up | 6014.928/ |
|
down | 2.344/ |
/ | / |
Changes in relative BECN1 gene expression after GR-M and PBM cell treatment with halogenated boroxine compared to negative control
HB concentrations (mg/mL) | GR-M cells | PBM cells | ||
---|---|---|---|---|
|
Fold change/P value |
|
Fold change/P value | |
up | 1.788/ |
up | 3.884/ |
|
down | 2.143/0.0815 | up | 1.848/ |
|
up | 2.202/0.322 | up | 15.735/ |
|
up | 1.04/0.83 | up | 62.542/ |
|
down | 3.188/ |
up | 72636.933/ |
Changes in relative SQSTM1 gene expression after GR-M and PBM cell treatment with halogenated boroxine compared to negative control
HB concentrations (mg/mL) | GR-M cells | PBM cells | ||
---|---|---|---|---|
|
Fold change/P value |
|
Fold change/P value | |
up | 1.387/0.1695 | down | 1.078/0.6465 | |
up | 3.643/ |
down | 1.951/0.153 | |
up | 11.612/ |
up | 5.764/ |
|
up | 6.92/ |
up | 7.424/ |
|
up | 3.295/ |
up | 1.004/0.6465 |