The potential of tumors to grow and metastasize is the consequence of not only oncogenic mutations but also the behavior of non-malignant cells in the tumor microenvironment [1]. Tumor cell metabolism, aerobic glycolysis, and production of lactate and H+ ions resulted in the acidic microenvironment [2]. Cancer cells’ distinct glycolytic metabolism generated an excessive level of lactic acid [3]. Thus, acidosis in the tumor microenvironment might result from the export of protons and lactic acid from tumor cells into the extracellular space by acid-base regulators like Na+/H+ exchangers and monocarboxylate transporters [4]. The pH of blood and tissue is closely regulated at a pH of 7.4 under normal physiological circumstances while the tumor microenvironment frequently had a pH range of 5.5–7.0 [5, 6]. Additionally, tumor cells intracellular pH is slightly alkaline compared to the external environment, which was reported to promote cell tumor progression [7]. Both T cells and macrophages were considered as the most important defense players against pathogens and cancer cells, respectively[8].
While nascent transformed cells could be eradicated by an innate immune response at an early stage, tumor progression could be targeted by an adaptive immune response motivated by antigen-specific T cells [9]. The anticancer immune response, associated with effector T cells, was documented to be extremely reliant on components of the microenvironment such as helper cells and cytokines [10]. However, the functions of various components are also influenced by environmental pH. Acidic pH could significantly hinder the function of standard immune cells. Furthermore, tumor-derived soluble factors facilitated the escape of cancer cells from immune surveillance, allowing tumor development and metastasis [11]. Failure of the immune system to detect and target transformed cells has already been reported in cancer development and progression [12]. Recently, macrophages were demonstrated to support cancer cells by secreting some chemokines [13]. Tumor cells might avoid T cell attack through a variety of mechanisms. However, it is unclear what causes cancer cells to evade immune response or immune clearance under the prevalence of acidic pH. The major populations of cells that infiltrate developing cancer include immune cells, fibroblasts, adipocytes, endothelial cells, and perivascular cells [14].
The T cells infiltrate different parts of a tumor differently depending on what extracellular matrix components were posing a hindrance to T cell motility. Additionally, there are different reports showing that T cell infiltration in the tumor is associated with better prognosis. This is well documented in a number of studies [15,16,17]. Keeping in mind the acidic microenvironment, the present study was designed to investigate the effect on interaction of cancer and immune cells i.e. T cells and macrophages. T cells and macrophages are the primary producers of interferon gamma (IFN-γ), one of the major immune-modulatory molecules, which directs various cellular events via transcriptional regulation of immunologically relevant genes [18]. IFN-γ has been shown to play an important role in the majority of immunological responses, including cell-mediated immunity and inflammatory responses [19]. It has been documented for its direct effect on tumor cells and was reported to play a major role in tumor cell eradication [20]. Interleukin 18 (IL-18) has been documented as an IFN-γ inducing factor [21]. The activation of IL-18 and its export have been demonstrated in humans and mice to target the immune cells and provoke IFN-γ production. Additionally, IFN-γ also played a role in antitumor immunity [22]. Therefore, IFN-γ has been considered as a major immune-modulatory molecule in the present study.
Furthermore, an acidic tumor microenvironment might reduce the efficacy of anticancer therapy [23].
Acidic pH has been recently demonstrated to induce the octamer-binding transcription factor 4, which further modulated the recruitment and reprograming of tumor-associated stromal cells and had an impact on the recruitment and activity of immune cells [24, 25]. Apart from tumor cells, the behavior of immune cells and their ability to invade the tumor were also dependent on the microenvironment as an intermediate medium. Therefore, we considered HeLa cells conditioned medium (HCM) under acidic pH as the tumor microenvironment in our study. The present investigation examined the effect of the acidic microenvironment generated by cancer cells on immune response in terms of expression of IFN-γ and IL-18. Further, attempts were also made to ascertain the role of the acidic microenvironment in modulating immune and cancer cells’ interactions.
Exponentially growing HeLa cells (human cervical cancer), Jurkat cells (human T cell lymphoma), and THP-1 cells (monocytes) were procured from the National Centre for Cell Science (NCCS), India. THP-1 (monocytes) were differentiated to macrophages by using PMA (5 ng/mL) for 48 h [26]. HeLa cells were allowed to adhere for 48 h before being exposed to experimental conditions. The cells were cultured at 37°C under humidified 5% CO2 and a 95% air atmosphere. The cell density was maintained at a level lesser than 3 × 105 cells/mL in 25 cm2 plastic tissue culture flasks with 10 mL of RPMI-1640. The culture medium was supplemented with 10% fetal bovine serum (Hi Media). LPS-free reagents were used during the experiments. The pH of the culture media was adjusted using 1N HCl. The experiments were carried out in the exosome-free fetal bovine serum [27].
To ascertain the effect of acidic pH on immune cells, Jurkat (T cells) and THP-1 (macrophages) cells were cultured in pH 7.4, pH 6.9, and pH 6.5 media (
The cytotoxic effect of acidic pH was studied on Jurkat, HeLa, and macrophages cells by the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) assay [29]. Briefly, the cells were cultured in 96 well plates at a density of 1 × 104 cells per well at different pH values (7.4, 6.9, and 6.5). After incubation for 24 h, MTT (5 mg/mL in PBS) was added to each well and further incubation was carried out at 37°C for 2 h. Dark blue formazan crystals formed were dissolved in DMSO and optical density was measured by a microplate reader (Bio-Rad) at a wavelength of 570 nm.
Isolation of total RNA from cells after exposing them to experimental conditions was done using TRIzol reagent (Sigma). First strand cDNA (complementary DNA) synthesis was carried out using the Verso cDNA kit (Thermo Scientific). DNA contamination in the isolated RNA was eliminated using the RT enhancer available with the kit. Semi-quantitative PCR was carried out and amplified PCR products were resolved by 2% agarose gel electrophoresis. Quantitative real-time PCR analysis was performed in a real-plex system (Eppendorf) using the SYBR Green PCR Master mix (Thermo Scientific). Real-time PCR was carried out for
Details of primers used in the study
5′ TCCCATGGGTTGTGTGTTTA 3′ (F) |
|
5′ GCCTAGAGGTATGGCTGTAA 3′(F) |
|
5′ AGGAGTCCTTGCTGGAGGA 3′ (F) |
|
5′ GTGGGCCGCTCTAGGCACCA 3′ (F) |
β-actin, beta actin; F, forward; IFN-
Both Jurkat and THP-1 cells (0.5 × 106 cells/mL) were washed in PBS, then fixed and permeabilized using the Cytofix/Cytoperm kit (BD Bioscience) for 20 min on ice. Cells were pelleted, washed with perm wash buffer (BD Bioscience), and stained for 1 h at 4°C with a fluorochrome-conjugated anti–IFN-γ monoclonal antibody (BD Bioscience). Cells were washed twice with a perm wash buffer and finally re-suspended in a perm wash buffer for flow cytometry analysis. Flow cytometric analysis was performed on BD FACS Canto II (BD Biosciences) for maximum cell counts of 10,000 and analyzed using BD FACSDiva software.
After culturing of HeLa cells for 24 h at different pH, the supernatant was collected and subjected to the centrifugation steps of 400 × g (10 min) to remove the intact cells, 3000 × g (20 min) to remove the cell debris, and 10,000 × g (30 min) to remove micro vesicles. The exosomes were then pelleted at 64,000 × g (110 min) and 100,000 × g (sucrose gradient) for 1 h. Total amount and concentration of exosomal proteins in the pooled samples were measured by the BCA method using protein estimation kit (Bangalore Genei) and subjected to western blot analysis (IL-18, CD 63).
Cells were harvested, washed with cold PBS, and lysed in lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% NP-40, 1 mM ethylene glycol-bis (b-aminoethyl ether)-tetraacetic acid, 1 mM EDTA, 50 mM NaF, 1 mM b-glycerophosphate, 2.5 mM sodium pyrophosphate, 1 mM orthovanadate, protease inhibitor cocktail, and 1 mM PMSF). Protein estimation was determined by the BCA method using a protein estimation kit (Bangalore Genei). An equal amount of cell lysate from different test samples was resolved on 10% SDS-PAGE followed by transfer onto a PVDF membrane. The blots were probed with (1:1000) anti NF-κB (Sigma), IL-18, p38 MAPK, and CD63. Horseradish peroxidase-conjugated secondary antibodies were used to detect immune reactive bands using 3,3′-diaminobenzidine as a substrate.
After treatment, Jurkat and THP-1 cells were suspended in hypotonic buffer (250 mM sucrose, 20 mM Hepes [pH 7.5], 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 100 μM PMSF) on ice and incubated for 30 min, followed by lysing the cells by vigorous pipetting for 30 min. Cell lysate from the previous step was centrifuged at 3000 rpm for 5 min at 4°C to remove nuclei. The supernatant was saved as cytoplasmic fraction. The pellet was washed again and saved as nuclear fraction and further subjected to western blotting as described above.
To determine the role of acidic environment (as an intermediate medium between cancer cells and immune cells) in the modulation of immune and cancer cells’ interactions, Jurkat or THP-1 cells were cultured in HCM of pH 6.5, pH 6.9, and pH 7.4 for 20 h and the obtained cell-free medium (CM1) was saved for cytotoxicity assessment (
The needed statistical procedures were applied using SPSS 13.0, and data are presented as mean ± standard error of mean (SEM). One-way ANOVA (Analysis of variance) was used to analyze the results and to determine the significance of the mean between groups.
The microenvironment around the tumor was reported to be acidic and plays a major role in cellular response [30]. Many cellular responses such as cytosolic and membrane-associated enzyme activities, ion transport activity, DNA synthesis, cAMP, and calcium levels are affected by acidic extracellular pH [31, 32]. Indeed, the tumor–stroma interface at tumor sites under the acidic microenvironment might have a diverse effect on tumor survival, outgrowth, organ homing, and invasion [33].
Before initiating the experimental study, the effect of acidic pH on the viability of cells was examined. The viability of HeLa and THP-1 cells did not differ significantly (
Upon exposure of Jurkat cells to acidic conditions (pH 6.5), the expression of IFN-γ mRNA declined in comparison with Jurkat cells exposed to pH 7.4 (
To explore the role of factors secreted by cancer cells that help them to evade the immune response, Jurkat cells and macrophages were cultured in HCM. Jurkat cells cultured in HCM at pH 6.9 and pH 6.5 demonstrated 1.5 fold (
The upregulation of IFN-γ in Jurkat and THP-1 cells cultured in HCM at acidic pH suggests that cancer cells may secrete biological factors to stimulate these cells. As a result, we examined the expression of IL-10 and IL-18, which have been shown to alter IFN-γ expression in various cells [34]. Total mRNA from HeLa cells (pH 7.4, pH 6.9, pH 6.5) was isolated and analyzed for the expression of IL-10 and IL-18 to investigate their role in IFN-γ expression. No expression of IL-10 was observed. However, enhanced expression of IL-18 was observed in HeLa cells cultured in a medium of acidic pH (
As previously stated, the acidic environment induced IL-18 correlated with IFN-γ upregulation in Jurkat and THP-1 cells. Therefore, attempts were made to decipher the behavior of HeLa cells in the culture medium taken from Jurkat and THP-1 cells grown in a medium of different pH. To investigate this, HeLa cells were cultured for 24 h in CM1 and CM2 (pH 7.4, pH 6.9, and pH 6.5) obtained from Jurkat cells to mimic the natural tumor conditions as described in the Methods section. HeLa cells showed 88% viability at pH 6.5 (
An acidic microenvironment around the tumor cells is a key feature of actively growing tumors. Immune cells are rarely in contact with cancer cells; instead, they occupy the interstitial acidic medium. Therefore, an attempt has been made in the present study to understand the mechanism by which the acidic microenvironment affected the tumor and immune cells’ interactions. The inhibition of acidic microenvironments by exploiting proton pump inhibitors has been widely studied [36, 37]. Recent studies revealed the chemosensitization of cancer cells that underwent proton pump inhibitor treatment [38, 39].
Jurkat and THP-1 were cultured in acidic pH media (pH 6.9, pH 6.5) and normal physiological pH (pH 7.4). The upregulation of IFN-γ following mild acidification of the medium to pH 6.9 around Jurkat cells suggests that mild acidification in the immune cell microenvironment might favor the IFN-γ mediated immune cell response. The downregulation of IFN-γ in response to pH 6.5, on the other hand, suggests that an acidic microenvironment can modify or restrict the IFN-γ mediated immune response. Similar research with THP-1 (macrophages) has suggested that acute acidification around immune cells could impair immune performance and reduce IFN-γ mediated immune response. These studies were in agreement with the previous studies where it was observed that the acidic environment generated by lactic acid could impair the expression of various cytokines and cytolytic activity, as well as cause anergy of T lymphocytes [40, 41]. The activity of natural killer (NK) cells, as well as lymphokine-activated killer (LAK) cells, has also been reported to be reduced along with the decreased release of TNF-α, IFN-γ, IL-10, IL-12, and transforming growth factor-1 (TGF-1) under acidic conditions [42, 43].
Furthermore, it was intriguing whether the interaction of cancer and immune cells would favor immune suppression or provoke the immune response in terms of IFN-γ in an acidic environment. These observations generated in the present study suggest that an acidic environment around cancer cells could enhance the IFN-γ mediated immune response by stimulating the immune cells. As a result, an acidic microenvironment might be beneficial in stimulating IFN-γ expression. Interestingly, a comparison between immune cells cultured in HCM (pH 7.4) to those without HCM (pH 7.4) suggests downregulation of IFN-γ. These findings suggest that under physiological pH (pH 7.4) conditions, cancer cells could secrete some unknown factors inhibiting IFN-γ expression by immune cells, there by helping cancer cells to evade immune response. This was in agreement with the previous studies where it had been shown that cancer cells secreted some unknown factors, which could lead to the suppression of cytokines [44]. When Jurkat and THP-1 cells were compared in HCM (pH 6.9, pH 6.5) and without HCM (pH 6.9, pH 6.5), IFN-γ was found to be upregulated. Under acidic conditions, it appeared that cancer cells secreted unknown biological factors that cause immune cells to secrete IFN-γ and stimulate the immune response. Therefore, the experiments were extended to ascertain the role of biological factors involved in stimulating IFN-γ. Under acidic conditions, HeLa cells could release exosome-anchored IL-18. IFN-γ expression in HCM-stimulated Jurkat and THP-1 cells can be boosted by exosome-anchored IL-18. These findings suggest that cancer cells might stimulate the immune response under acidic conditions by upregulating the IFN-γ associated with IL-18. Furthermore, the nuclear localization of NF-κB in Jurkat and THP-1 cells cultured in HCM (pH 6.9, pH 6.5) medium versus HCM (pH 7.4) medium suggests an involvement of IL-18 and NF-κB mediated pathways in IFN-γ stimulated cell survival.
Further attempts were made to investigate how cancer cells could escape the IFN-γ mediated attack stimulated by cancer cells via IL-18 on immune cells in an acidic environment and what role the acidic medium played as an intermediary medium between the interactions of cancer and immune cells. Therefore, a cytotoxic effect assessment after the reversal of pH was performed. Results revealed that reversal and retaining of the pH to 7.4 improved the cytotoxic effect of the immune cells. This study suggests that, while cancer cells could stimulate IFN-γ expression in immune cells, the efficiency of IFN-γ in an acidic environment was compromised. Overall, it appeared that the acidic microenvironment around the tumor and immune system could interfere with immune response, and reversal of this tumor microenvironment could be a novel approach to enhance immunotherapy and treat the tumor. Similarly, a recent study revealed that an acidic environment could impair the function of immune cells, which could be reverted by blocking the acidic environment [45, 46]. Furthermore, Pilon-Thomas et al. [47] suggested that the reversal of tumor pH could also improve the potential of immune cells to fight cancer [48]. Overall, this study suggests that the acidic environment could not only restrict the immune cells’ performance by downregulating the major effector molecules like IFN-γ but also act as a barrier by modulating the various major effector molecules like IFN-γ in the extracellular environment. Hence, it contributes to immune escape. These findings agree with those of Fischer et al. [41], who discovered that acidosis impairs cytolytic activity and causes anergy in CD8+ T lymphocytes.
According to the findings, the acidic pH around cancer cells alters the expression of cytokines like IFN-γ in immune cells. The acidic microenvironment also modulated the interaction between cancer and immune cells through IFN-γ that was regulated by IL-18 and the NF-κB mediated pathway. Besides, it could also restrict the immune response by acting as an intermediate modulating medium resulting in immune escape. Therefore, managing the acidic microenvironment could provide a significant approach to anticancer and immunotherapy. Although the present study provides the preliminary evidences about the role of acidic microenvironment in cancer and immune cells interactions. The study provides evidences from in vitro models. The study must be validated in vivo models to reach specific conclusions.