Morphological and molecular characters of Scutellonema brachyurus (Steiner, 1938) Andrássy, 1958 from South Africa

Rhizosphere soil samples were collected from the natural grass from North West and Limpopo provinces of South Africa. Nematode extraction was achieved using the Baermann (1917) funnel technique. Subsequent, extracted individuals were fixed with a hot 4% formaldehyde solution (except those specimens used for molecular analyses) and transferred to anhydrous glycerine utilizing the method of De Grisse (1969) and mounted on permanent glass slides.

Measurements were taken of specimens mounted on permanent slides, and De Man (1880) indices were calculated. Drawings were made using a drawing tube (camera lucida) attached to an Omax microscope (China). Pictures were taken with a Nikon Eclipse 80i light microscope provided with differential interference contrast optics (DIC) and a Nikon Digital Sight DS-U1 camera (Nikon, Tokyo, Japan). Micrographs were edited using Adobe® Photoshop® CS. The terminology used for the morphology of stoma follows the proposals by Baldwin et al. (2004).

Specimens preserved in glycerine were selected for observation under SEM, according to Shokoohi et al. (2007). The nematodes were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany).

To evaluate the morphological variations between the nematodes isolated in this study and the S. brachyurus populations, principal component analyses (PCA) with different morphological traits were conducted. PCA analyses were carried out in XLSTAT (Addinsoft, 2007). Various morphometric features obtained from fixed nematodes, including an average of body length, a, b, b’, c, c’, V, stylet length, DGO, m, o, excretory pore to anterior end, neck length, mid-body diameter, anal body diameter, and tail length were included in the PCA analyses (Table 2). The morphometric measurements of the PCA analysis were taken from their original descriptions (Table 2). The measures were normalized using the XLSTAT software before its analysis (Addinsoft, 2007). The scores values were determined for each species based on each of the principal components, and the scores for the first two components were used to form a two-dimensional plot (F1 and F2) of each isolate based on the eigenvalues given by the software XLSTAT.

DNA extraction was done using the Chelex method (Straube and Juen, 2013). Five specimens of each locality for S. brachyurus were hand-picked with a fine tip needle and transferred to a 1.5 ml Eppendorf tube containing 20 μ l double distilled water. The nematodes in the tube were crushed with the tip of a fine needle and vortexed. Thirty microliters of 5% Chelex® 50 and 2 µL of proteinase K were added to each of the microcentrifuge tubes that contained the crushed nematodes and mixed. These separate microcentrifuge tubes with the nematode lysate were incubated at 56°C for 2  and then incubated at 95°C for 10 min to deactivate the proteinase K and finally spin for 2 min at 16,000 rpm (Shokoohi et al., 2018). The supernatant was then extracted from each of the tubes and stored at –20°C. Following this step, the forward and reverse primers, D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’), D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (De Ley et al., 1999), and JB3 (5’–TTTTTTGGGCATCCTGAGGTTTAT–3’), JB4.5 (5’–TAAAGA AAGAACATAATGAAAATG–3’) (Derycke et al., 2010), were used in the PCR reactions for partial amplification of the 28 S rDNA and COI of mtDNA regions, respectively. PCR was conducted with 8μ l of the DNA template, 12.5 μ l of 2X PCR Master Mix Red (Promega, USA) for the Botswanan specimens, 1 μ l of each primer (10 pmol μ l⁻¹), and ddH₂O for a final volume of 30 μ l. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program: initial denaturation for 3 min at 94°C, 37 cycles of denaturation for 45 s at 94°C; 56°C and 52°C annealing temperatures for 28 S rDNA and COI, respectively; extension for 45 s to 1 min at 72°C, and finally an extension step of 6 min at 72°C followed by a temperature on hold at 4°C. After DNA amplification, 4 μ l of product from each tube was loaded on a 1% agarose gel in TBE buffer (40 mM Tris, 40 mM boric acid, and 1 mM EDTA) for evaluation of the DNA bands. The bands were stained with RedGel and visualized and photographed on a UV transilluminator. The amplicons of each gene were stored at –20°C. Finally, the PCR products were purified for sequencing by Inqaba Biotech (South Africa). Also, Hoplolaimus galeatus (Cobb, 1913) Thorne, 1935 (KY849910; KP230651) were selected based on Kolombia et al. (2017) for 28 S rDNA and COI of mtDNA outgroups, respectively. The ribosomal DNA sequences were analyzed and edited with BioEdit (Hall, 1999) and aligned using CLUSTAL W (Thompson et al., 1994). The length of the alignments was 1,194 bp for 28 S rDNA. Phylogenetic trees were generated using the Bayesian inference method as implemented in the program Mr. Bayes 3.1.2 (Ronquist and Huelsenbeck, 2003). The GTR + I + G model was selected using the jModeltest 2.1.10 (Darriba et al., 2012; Guindon and Gascuel, 2003). The selected model was then initiated with a random starting tree and ran with the Markov chain Monte Carlo (MCMC) for 10⁶ generations. The genetic pairwise distance was calculated using the Mega-X software (Kumar et al., 2018). The partial 28 S rDNA of S. brachyurus was deposited in GenBank, and their accession numbers MW504474 (Parys; North West Province), MW504475 (Rustenburg; North West Province) and MW504476 (Sovenga Hills; Limpopo Province). The partial COI of mtDNA was deposited in GenBank under accession number MW509624 (Rustenburg; North West Province).

Figures 1–3

Figure 1:

Figure 2:

Figure 3:

Material examined: eight females in good condition.

Measurements: see Table 1.

Specimens of S. brachyurus were collected in North West Province (Rustenburg: S 25° 40’ 55.215”, E 27° 14’ 36.028” and Parys: S 26° 54’ 37.336”, E 27° 27’ 24.582”), and Limpopo Province (Sovenga Hill; S 23° 53’ 41.763”, E 29° 44’ 21.292”), around the rhizosphere of natural grass.

Principal component analysis using morphometric features of the females of S. brachyurus, including the populations from South Africa, showed that S. brachyurus has morphometric variation. Specifically, we have selected 16 morphometric variables for the mature females, which allowed for clear differentiation of different populations for S. brachyurus (Figure 4).

Figure 4:

An accumulated variability of 58.47% was observed in female-based PCA, specifically, 37.68% in the F1 and 20.79% in the F2. Almost all the variables showed a positive correlation between them and were responsible for the significant variability of the F1, while some variables such as L, b, b’, c’, stylet length, neck length, anal body diameter and tail length displayed a negative correlation (Figure 4, Table 2). The variables V (r = 0.957), o (r = 0.913), and DGO (r = 0.816) were responsible for the significant variability of the F1 (Figure 4). Regarding the F2, maximum body diameter (r = 0.931) had the most contribution to the variability and showed a positive and high correlation (Table 2). Overall, the result indicated that the population from South Africa stands together. In contrast, the populations from America and Belgium grouped together (Table 3 and Figure 4). The result indicated low variability within the South African population for S. brachyurus. The result indicated that S. clavicaudatum Van den Berg et al., 2017 place separately than other S. brcahyurus populations.

Phylogenetic analysis

The Bayesian inference tree of 28 S rDNA of Scutellonema species (Figure 5) grouped them into seven clades, including (I) S. clathricaudatum Whitehead, 1959 with 1.00 posterior probability; (II) S. cavenessi Sher, 1964 with 1.00 posterior probability; (III) S. bradys with 1.00 posterior probability; (IV) S. transvaalense Van den Berg, 1981 with 1.00 posterior probability; (V) S. paralabiatum Siddiqi and Sharma, 1994 with 1.00 posterior probability; (VI) S. truncatum Sher, 1964 with 1.00 posterior probability; and (VII) S. clavicaudatum and S. brachyurus with 1.00 posterior probability.

Figure 5:

The Bayesian inference tree of COI of mtDNA of Scutellonema species (Figure 6) grouped them into six clades, including (I) S. bradys with 1.00 posterior probability; (II) S. clathricaudatum with 1.00 posterior probability; (III) S. cavenessi with 1.00 posterior probability; (IV) S. paralabiatum with 1.00 posterior probability; (V) S. truncatum with 1.00 posterior probability; (VI) S. transvaalense with 1.00 posterior probability; and (VII) S. brachyurus with 0.63 posterior probability.

Figure 6: