Species | Individual | Soil sample code | Sample locality (Voivodeship) | Coordinates | Vegetation type | 28S rDNA GenBank number | mtCOI GenBank number |
---|---|---|---|---|---|---|---|
|
1 | CH 0040/04 | Dobrzyca (West Pomeranian) | N 54.172277 E 15.926119 |
|
MG653526 | MG663098 |
|
2 | CH 0197/01 | Ligota Mała (Lower Silesian) | N 51.126219 E 17.346800 |
|
– | MG663099 |
3 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 |
|
MG653526 | MG663100 | |
4 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 |
|
MG653527 | – | |
5 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 |
|
– | MG663101 | |
6 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 |
|
MG653526 | – | |
|
1 | KW 0014/05 | Sierpówko (Greater Poland) | N 52.473777 E 16.585961 | Mixed forest | MG653532 | MG663104 |
|
2 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | MG653533 | MG663104 |
3 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | MG653533 | MG663105 | |
4 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | – | MG663106 | |
5 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 |
|
MG653534 | MG663107 | |
6 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 |
|
MG653532 | MG663108 | |
7 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 |
|
– | MG663109 | |
8 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 |
|
– | MG663110 | |
9 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 |
|
MG653532 | MG663111 | |
10 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 |
|
– | MG663112 | |
11 | KW 0078/01 | Radomierz (Lower Silesian) | N 50.909560 E 15.911490 | Poaceae (R. Br.) Barnh.; meadow | MG653534 | – | |
12 | KW 0078/01 | Radomierz (Lower Silesian) | N 50.909560 E 15.911490 | Poaceae (R. Br.) Barnh.; meadow | MG653533 | MG663113 | |
13 | KW 0080/02 | Rybnica (Lower Silesian) | N 50.908020 E 15.675000 | Fagopyrum Mill; cultivation | MG653532 | – | |
|
1 | KW 0013/02 | Turew (Greater Poland) | N 52.060160 E 16.819668 |
|
– | MG663114 |
|
2 | KW 0013/01 | Turew (Greater Poland) | N 52.060160 E 16.819668 |
|
– | MG663115 |
3 | KW 0154/01/01 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 |
|
MG653535 | – | |
4 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 |
|
MG653535 | MG663116 | |
5 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 |
|
MG653535 | MG663117 | |
6 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 |
|
– | MG663118 | |
7 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 |
|
– | MG663119 | |
8 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 |
|
MG653535 | MG663119 | |
9 | KW 0154/01/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 |
|
– | MG663120 | |
|
1 | KW 0084/01 | Czernia (Lubusz) | N 51.534330 E 15.240710 |
|
MG653536 | – |
|
2 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 |
|
MG653537 | – |
3 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 |
|
MG653536 | – | |
4 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 |
|
MG653538 | MG663121 | |
5 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 |
|
MG653539 | – | |
6 | KW 0067/01 | Toruń (Kuyavian-Pomeranian) | N 53.027500 E 18.595470 | lawn | MG653540 | MG663122 |
Locality | Populations analyzed in this study, Poland | Holotype, Rothamsted, England, |
Paratypes, Rothamsted, England, |
Populations from New Zealand |
Populations from temperate Europe |
Population from Portugal |
Populations analyzed in this study, Poland | Population from Portugal |
---|---|---|---|---|---|---|---|---|
|
5 females | 19 females | 48 females | 40 females | 4 males | 10 males | ||
L | 734.7 ± 101.1 (623.8–876.5) | 670 | 580–670 | 586–814 | 520–790 | 510–890 | 676.3 ± 39.1 (612.8–715.2) | 530–700 |
a | 24.9 ± 0.9 (24.8–26.0) | 22 | 18–26 | 22–32 | 18–29 | 23.5–35.8 | 25.0 ± 2.4 (22.5–27.8) | 30.3–37.4 |
b | 5.5 ± 1.2 (4.2–7.2) | 4.8 | 4.3–5.2 | 4.9–7.7 | 4.3–7.5 | 5.8–8.7 | 6.7 ± 0.7 (5.7–7.2) | 6.6–8.5 |
c | 42.5 ± 7.3 (34.1–52.4) | – | 39–50 | 36–77 | 38–75 | 39.4–70 | 33.5 ± 2.2 (31.4–37.2) | 34–37.3 |
c′ | 1.3 ± 0.5 (0.7–1.8) | – | – | 0.6–1 | 0.5–1.2 | 0.7–1.3 | 1.7 ± 0.1 (1.6–1.9) | 1.6–2.2 |
V | 62.5 ± 1.9 (60.1–65) | 62 | 60–63 | 59–67 | 59–66 | 61–67 | ||
Stylet length | 29.7 ± 1.2 (29.0–31.3) | 32 | 29–33 | 31–33 | 25–33 | 22–26 | 26.3 ± 0.7 (25.2–27.1) | 20–23 |
Pharyngal length | 131.9 ± 7.0 (120.7–139.9) | – | – | 104–136 | 99–113 | 120–167 | 113.8 ± 15.0 (99.3–134.5) | 126–172 |
Max. body diam.a | 31.3 ± 6.5 (24.0–40.3) | – | – | 22–34 | – | 14–26 | 25.9 ± 3.0 (24.6–30.7) | 17–20 |
Tail length | 17.8 ± 4.1 (13.3–21.4) | – | 12–17 | 8–19 | 8–19 | 9.5–17.5 | 20.3 ± 1.1 (19.2–22.0) | 17–20 |
Anal body diam. | 14.8 ± 2.8 (12.0–15.4) | – | – | – | – | 10–17 | 11.9 ± 1.1 (10.4–13.6) | 9–11 |
Tail annuli number | 5.8 ± 1.3 (4–7) | – | 6–11 | 6–12 | 4–14 | 4–8 | – | 8–11 |
Phasmid position (number of annules anterior to anus) | 2.0 ± 2 (0–5) | – | – | −1–+5 | −3–+3 | −1–+4 | – | −4–+7 |
Spicula length | 28.1 ± 1.9 (26.5–30.7) | 20–25 | ||||||
Gubernaculum | 9.1 ± 0.9 (7.9–10.2) | 4.4–7.0 |
Locality | Populations analyzed in this study, Poland | Topotypes, Switzerland |
Topotypes, Switzerland |
Populations from New Zealand |
Populations from temperate Europe |
Populations from California, USA |
Populations from Iran |
---|---|---|---|---|---|---|---|
|
13 | 20 | 20 | 86 | 25 | 22 | |
L | 767.2 ± 81.3 (675.1–865.9) | 600–820 | 764 | 697–840 | 560–820 | 642–895 | 666–934 |
a | 26.4 ± 4.7 (21.7–34.3) | 27–34 | 28 | 27.5–34.9 | 24–34 | 25.3–31.8 | 24–35 |
b | 6.0 ± 0.9 (5.8–8.1) | 6.0–7.2 | – | 5.0–8.1 | 4.2–8.6 | 5.1–7.3 | 4.2–6.6 |
c | 42.6 ± 12.2 (34.1–64.0) | 32–52 | 48.4 | 33–61 | 32–52 | 31.2–46.9 | 32.6–59 |
c′ | 1.0 ± 0.3 (0.6–1.5) | 0.9–1.4 | – | 0.9–1.5 | 0.8–1.4 | 1.0–1.4 | 1–3.2 |
V | 61.9 ± 5.5 (48.1–71.8) | 59–64 | 61.6 | 59–66 | 59–67 | 58.4–64.6 | 46–65 |
Stylet length | 28.0 ± 0.7 (26.5–29.5) | 26–30 | 27.1 | 22–28 | 24–30.5 | 25–27.5 | 23–27 |
Pharyngal length | 124.9 ± 21.3 (102.7–173.4) | – | 116 | 133–178 | 104–128 | 116–160 | 120–148 |
Max. body diam.a | 29.1 ± 4.9 (21.9–35.5) | – | 27.8 | 23.7–28.5 | – | 25–31 | 24–31 |
Tail length | 17.3 ± 3.3 (12.5–23.20) | – | 15.9 | 14.6–19.5 | 15–22 | 16–24 | 13.7–24.5 |
Anal body diam. | 13.9 ± 2.2 (12.2–19.7) | – | 15.6 | – | – | 15–20 | 13.7–16 |
Tail annuli number | 10.0 ± 2.4 (6.0–13.0) | 7–12 | – | – | 7–17 | 8–15 | – |
Phasmid position (number of annules anterior to anus) | 7.5 ± 2.3 (4–10) | 2–7 | 3–11 | 6–11 | 2–12 | 5–10 | – |
Forward primer (5′-3′) | Reverse primer (5′-3′) | Approximate amplicon size | Name of species and corresponding GenBank sequence numbers |
---|---|---|---|
M3.5F: GGAGTGGiACARGiTGAAC | M8aRa: GCAACiACATAATAAGWATCATG | 700 |
|
|
|||
M6.9R: ACCiACARTAAAiATATGATG | 450 |
|
|
|
|||
|
|||
M2Fb: ATTGGiGSTTTTGGTAATT | RH1R: CCAACAATGAATATATGATG | 600 |
|
|
|||
|
|||
RH2F: GGTGGAAGAATTAATTTYTG | 350 |
|
|
|
Locality | Populations analyzed in this study, Poland | Holotype, Quebec, Canada |
Paratypes, Quebec, Canada |
Rothamsted, England |
Populations from New Zealand, |
Populations from temperate Europe, |
---|---|---|---|---|---|---|
|
5 | 15 | 20 | 25 | ||
L | 793.1 ± 54 (698.7–866.6) | 860 | 780 (680–970) | 680–840 | 726–906 | 680–1040 |
a | 22.4 ± 1.16 (20.9–24.1) | 24.5 | 24.3 (20.0–30.4) | 18–26 | 23–31 | 20–31 |
b | 5.9 ± 0.34 (5.3–6.3) | 5.2 | 5.4 (4.8–6.7) | 5.3–6.2 | 5.4–7.9 | 5.3–8.1 |
c | 50.5 ± 8.1 (38.5–61.8) | 62.3 | 56.4 (48.7–65.0) | 36–54 | 45–63 | 36–72 |
c′ | 0.9 ± 0.1 (0.8–1.1) | 0.9–1.4 | – | – | 0.7–1.1 | 0.6–1.0 |
V | 58.3 ± 1.9 (55.5–59.5) | 64 | 64(61–66) | 59–64 | 57–63 | 58–66 |
Stylet length | 28.8 ± 0.94 (28.2–30.7) | 30 | 30 (28–30) | 31–33 | 28–33 | 27–33.5 |
Pharyngal length | 135.1 ± 11.6 (120.2–152.7) | – | – | – | 150–175 | 103–140 |
Max. body diam.a | 35.4 ± 2.9 (30.3–38.9) | – | – | – | 26–37 | – |
Tail length | 16.2 ± 3.1 (11.3–20.5) | – | 12–16 | 15–22 | 13–19 | 12–22 |
Anal body diameter | 17.9 ± 2.34 (13.3–20.3) | – | – | – | – | – |
Tail annuli number | 13.2 ± 2.5 (10.0–16.0) | – | – | 8–12 | 8–12 | 6–12 |
Phasmid position (number of annules anterior to anus) | 5.0±2.7 (3.0-9.0) | – | – | 4–9 | 6–12 | 3–12 |