Open Access

Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data


Cite

Figure 1:

Anterior and posterior regions of three Helicotylenchus species: (A) Anterior body and (D) tail of H. canadensis (CH 0199/01). (B) Anterior body and (E) tail of H. pseudorobustus (KW 0154/01). (C) Anterior body and (F) tail of H. varicaudatus female (KW 0154/02). (Scale bar =10 μm).
Anterior and posterior regions of three Helicotylenchus species: (A) Anterior body and (D) tail of H. canadensis (CH 0199/01). (B) Anterior body and (E) tail of H. pseudorobustus (KW 0154/01). (C) Anterior body and (F) tail of H. varicaudatus female (KW 0154/02). (Scale bar =10 μm).

Figure 2:

Anterior and posterior regions of H. varicaudatus male (KW 0154/02). (A) Anterior body. (B) Tail, with focus on spicule and gubernaculum. (C) Tail, with focus on bursa and phasmid. Images of male were captured from the video documentation of temporary slides.
Anterior and posterior regions of H. varicaudatus male (KW 0154/02). (A) Anterior body. (B) Tail, with focus on spicule and gubernaculum. (C) Tail, with focus on bursa and phasmid. Images of male were captured from the video documentation of temporary slides.

Figure 3:

The alignment of partial mtCOI sequences from representatives of Hoplolaimidae, translated from nucleotide into amino acid sequences using the standard invertebrate mitochondrial genetic code. X, unknown amino acid; *, TAA (grey frame) or TAG (black frame) codon.
The alignment of partial mtCOI sequences from representatives of Hoplolaimidae, translated from nucleotide into amino acid sequences using the standard invertebrate mitochondrial genetic code. X, unknown amino acid; *, TAA (grey frame) or TAG (black frame) codon.

Figure 4:

Phylogeny of the genus Helicotylenchus, as inferred by Bayesian analysis of 28S rDNA. The numbers near nodes indicate posterior probabilities. Roman numerals indicate major clades following Subbotin et al. (2011, 2015). The original 28S rDNA sequences are in boldface font.
Phylogeny of the genus Helicotylenchus, as inferred by Bayesian analysis of 28S rDNA. The numbers near nodes indicate posterior probabilities. Roman numerals indicate major clades following Subbotin et al. (2011, 2015). The original 28S rDNA sequences are in boldface font.

Figure 5:

Phylogeny of the genus Helicotylenchus, as inferred by Baysian analysis of partial mtCOI sequences. Roman numerals indicate major clades according to Subbotin et al. (2011, 2015). The original mtCOI sequences are in boldface font.
Phylogeny of the genus Helicotylenchus, as inferred by Baysian analysis of partial mtCOI sequences. Roman numerals indicate major clades according to Subbotin et al. (2011, 2015). The original mtCOI sequences are in boldface font.

Hoplolaimidae species included in phylogenetic analyses.

Species Individual Soil sample code Sample locality (Voivodeship) Coordinates Vegetation type 28S rDNA GenBank number mtCOI GenBank number
Helicotylenchus 1 CH 0040/04 Dobrzyca (West Pomeranian) N 54.172277 E 15.926119 Buxus sempervirens L.; nursery MG653526 MG663098
canadensis 2 CH 0197/01 Ligota Mała (Lower Silesian) N 51.126219 E 17.346800 Rosa L.; cultivation MG663099
3 CH 0199/01 Kąty Bystrzyckie (Lower Silesian) N 50.312597 E 16.840489 Rosa L.; cultivation MG653526 MG663100
4 CH 0199/01 Kąty Bystrzyckie (Lower Silesian) N 50.312597 E 16.840489 Rosa L.; cultivation MG653527
5 CH 0199/01 Kąty Bystrzyckie (Lower Silesian) N 50.312597 E 16.840489 Rosa L.; cultivation MG663101
6 CH 0199/01 Kąty Bystrzyckie (Lower Silesian) N 50.312597 E 16.840489 Rosa L.; cultivation MG653526
Helicotylenchus 1 KW 0014/05 Sierpówko (Greater Poland) N 52.473777 E 16.585961 Mixed forest MG653532 MG663104
pseudorobustus 2 KW 0063/04 Brzostów (Greater Poland) N 51.978670 E 17.405130 Mixed forest MG653533 MG663104
3 KW 0063/04 Brzostów (Greater Poland) N 51.978670 E 17.405130 Mixed forest MG653533 MG663105
4 KW 0063/04 Brzostów (Greater Poland) N 51.978670 E 17.405130 Mixed forest MG663106
5 KW 0008/01 Kleszczele (Podlaskie) N 52.563534 E 23.312296 Solanum tuberosum L.; cultivation MG653534 MG663107
6 KW 0008/01 Kleszczele (Podlaskie) N 52.563534 E 23.312296 Solanum tuberosum L.; cultivation MG653532 MG663108
7 KW 0008/01 Kleszczele (Podlaskie) N 52.563534 E 23.312296 Solanum tuberosum L.; cultivation MG663109
8 KW 0154/01/02 Nowy Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG663110
9 KW 0154/01/02 Nowy Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG653532 MG663111
10 KW 0154/01/02 Nowy Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG663112
11 KW 0078/01 Radomierz (Lower Silesian) N 50.909560 E 15.911490 Poaceae (R. Br.) Barnh.; meadow MG653534
12 KW 0078/01 Radomierz (Lower Silesian) N 50.909560 E 15.911490 Poaceae (R. Br.) Barnh.; meadow MG653533 MG663113
13 KW 0080/02 Rybnica (Lower Silesian) N 50.908020 E 15.675000 Fagopyrum Mill; cultivation MG653532
Helicotylenchus 1 KW 0013/02 Turew (Greater Poland) N 52.060160 E 16.819668 Tilia L.; park MG663114
varicaudatus 2 KW 0013/01 Turew (Greater Poland) N 52.060160 E 16.819668 Platanus L.; park MG663115
3 KW 0154/01/01 Nowy Duninów and Stary Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG653535
4 KW 0154/02 Nowy Duninów and Stary Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG653535 MG663116
5 KW 0154/02 Nowy Duninów and Stary Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG653535 MG663117
6 KW 0154/02 Nowy Duninów and Stary Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG663118
7 KW 0154/02 Nowy Duninów and Stary Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG663119
8 KW 0154/02 Nowy Duninów and Stary Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG653535 MG663119
9 KW 0154/01/02 Nowy Duninów and Stary Duninów (Masovian) N 52.577483 E 19.502000 Acer negundo L.; fallow MG663120
Rotylenchus 1 KW 0084/01 Czernia (Lubusz) N 51.534330 E 15.240710 Secale L.; cultivation MG653536
uniformis 2 KW 0088/01 Miodnica and Gorzupia (Lubusz) N 51.708180 E 15.288050 Solanum tuberosum L.; cultivation MG653537
3 KW 0088/01 Miodnica and Gorzupia (Lubusz) N 51.708180 E 15.288050 Solanum tuberosum L.; cultivation MG653536
4 KW 0088/01 Miodnica and Gorzupia (Lubusz) N 51.708180 E 15.288050 Solanum tuberosum L.; cultivation MG653538 MG663121
5 KW 0088/01 Miodnica and Gorzupia (Lubusz) N 51.708180 E 15.288050 Solanum tuberosum L.; cultivation MG653539
6 KW 0067/01 Toruń (Kuyavian-Pomeranian) N 53.027500 E 18.595470 lawn MG653540 MG663122

Morphometrics of Helicotylenchus varicaudatus populations from different localities.

Locality Populations analyzed in this study, Poland Holotype, Rothamsted, England, acc. (Yuen, 1964) Paratypes, Rothamsted, England, acc. (Yuen, 1964) Populations from New Zealand acc. (Yeates and Wouts, 1992) Populations from temperate Europe acc. (Brzeski, 1998) Population from Portugal acc. (Schreck Reis et al., 2010) Populations analyzed in this study, Poland Population from Portugal acc. (Schreck Reis et al., 2010)
n 5 females 19 females 48 females 40 females 4 males 10 males
L 734.7 ± 101.1 (623.8–876.5) 670 580–670 586–814 520–790 510–890 676.3 ± 39.1 (612.8–715.2) 530–700
a 24.9 ± 0.9 (24.8–26.0) 22 18–26 22–32 18–29 23.5–35.8 25.0 ± 2.4 (22.5–27.8) 30.3–37.4
b 5.5 ± 1.2 (4.2–7.2) 4.8 4.3–5.2 4.9–7.7 4.3–7.5 5.8–8.7 6.7 ± 0.7 (5.7–7.2) 6.6–8.5
c 42.5 ± 7.3 (34.1–52.4) 39–50 36–77 38–75 39.4–70 33.5 ± 2.2 (31.4–37.2) 34–37.3
c′ 1.3 ± 0.5 (0.7–1.8) 0.6–1 0.5–1.2 0.7–1.3 1.7 ± 0.1 (1.6–1.9) 1.6–2.2
V 62.5 ± 1.9 (60.1–65) 62 60–63 59–67 59–66 61–67
Stylet length 29.7 ± 1.2 (29.0–31.3) 32 29–33 31–33 25–33 22–26 26.3 ± 0.7 (25.2–27.1) 20–23
Pharyngal length 131.9 ± 7.0 (120.7–139.9) 104–136 99–113 120–167 113.8 ± 15.0 (99.3–134.5) 126–172
Max. body diam.a 31.3 ± 6.5 (24.0–40.3) 22–34 14–26 25.9 ± 3.0 (24.6–30.7) 17–20
Tail length 17.8 ± 4.1 (13.3–21.4) 12–17 8–19 8–19 9.5–17.5 20.3 ± 1.1 (19.2–22.0) 17–20
Anal body diam. 14.8 ± 2.8 (12.0–15.4) 10–17 11.9 ± 1.1 (10.4–13.6) 9–11
Tail annuli number 5.8 ± 1.3 (4–7) 6–11 6–12 4–14 4–8 8–11
Phasmid position (number of annules anterior to anus) 2.0 ± 2 (0–5) −1–+5 −3–+3 −1–+4 −4–+7
Spicula length 28.1 ± 1.9 (26.5–30.7) 20–25
Gubernaculum 9.1 ± 0.9 (7.9–10.2) 4.4–7.0

Morphometrics of Helicotylenchus pseudorobustus populations from different localities.

Locality Populations analyzed in this study, Poland Topotypes, Switzerland acc. (Sher, 1966) Topotypes, Switzerland acc. (Fortuner et al., 1984) Populations from New Zealand acc. (Yeates and Wouts, 1992) Populations from temperate Europe acc. (Brzeski, 1998) Populations from California, USA acc. (Subbotin et al., 2015) Populations from Iran acc. (Shokoohi et al., 2018)
n 13 20 20 86 25 22
L 767.2 ± 81.3 (675.1–865.9) 600–820 764 697–840 560–820 642–895 666–934
a 26.4 ± 4.7 (21.7–34.3) 27–34 28 27.5–34.9 24–34 25.3–31.8 24–35
b 6.0 ± 0.9 (5.8–8.1) 6.0–7.2 5.0–8.1 4.2–8.6 5.1–7.3 4.2–6.6
c 42.6 ± 12.2 (34.1–64.0) 32–52 48.4 33–61 32–52 31.2–46.9 32.6–59
c′ 1.0 ± 0.3 (0.6–1.5) 0.9–1.4 0.9–1.5 0.8–1.4 1.0–1.4 1–3.2
V 61.9 ± 5.5 (48.1–71.8) 59–64 61.6 59–66 59–67 58.4–64.6 46–65
Stylet length 28.0 ± 0.7 (26.5–29.5) 26–30 27.1 22–28 24–30.5 25–27.5 23–27
Pharyngal length 124.9 ± 21.3 (102.7–173.4) 116 133–178 104–128 116–160 120–148
Max. body diam.a 29.1 ± 4.9 (21.9–35.5) 27.8 23.7–28.5 25–31 24–31
Tail length 17.3 ± 3.3 (12.5–23.20) 15.9 14.6–19.5 15–22 16–24 13.7–24.5
Anal body diam. 13.9 ± 2.2 (12.2–19.7) 15.6 15–20 13.7–16
Tail annuli number 10.0 ± 2.4 (6.0–13.0) 7–12 7–17 8–15
Phasmid position (number of annules anterior to anus) 7.5 ± 2.3 (4–10) 2–7 3–11 6–11 2–12 5–10

Overview of PCR primers designed in this study, which were used for mtCOI amplification from three Helicotylenchus spp. and one Rotylenchus sp.

Forward primer (5′-3′) Reverse primer (5′-3′) Approximate amplicon size Name of species and corresponding GenBank sequence numbers
M3.5F: GGAGTGGiACARGiTGAAC M8aRa: GCAACiACATAATAAGWATCATG 700 H. pseudorobustus: MG663105
R. uniformis: MG663121
M6.9R: ACCiACARTAAAiATATGATG 450 H. pseudorobustus: MG663104
H. varicaudatus: MG663116; MG663116; MG663116
R. uniformis: MG663122
M2Fb: ATTGGiGSTTTTGGTAATT RH1R: CCAACAATGAATATATGATG 600 H. canadensis: MG663099; MG663100
H. pseudorobustus: MG663106; MG663107; MG663109; MG663110; MG663111; MG663112; MG663113
H. varicaudatus: MG663115
RH2F: GGTGGAAGAATTAATTTYTG 350 H. canadensis: MG663098; MG663101
H. varicaudatus: MG663114; MG663118; MG663120

Morphometrics of Helicotylenchus canadensis populations from different localities.

Locality Populations analyzed in this study, Poland Holotype, Quebec, Canada acc. (Waseem, 1961) Paratypes, Quebec, Canada acc. (Waseem, 1961) Rothamsted, England acc. Yuen, 1964 Populations from New Zealand, acc. (Yeates and Wouts, 1992) Populations from temperate Europe, acc. (Brzeski, 1998)
n 5 15 20 25
L 793.1 ± 54 (698.7–866.6) 860 780 (680–970) 680–840 726–906 680–1040
a 22.4 ± 1.16 (20.9–24.1) 24.5 24.3 (20.0–30.4) 18–26 23–31 20–31
b 5.9 ± 0.34 (5.3–6.3) 5.2 5.4 (4.8–6.7) 5.3–6.2 5.4–7.9 5.3–8.1
c 50.5 ± 8.1 (38.5–61.8) 62.3 56.4 (48.7–65.0) 36–54 45–63 36–72
c′ 0.9 ± 0.1 (0.8–1.1) 0.9–1.4 0.7–1.1 0.6–1.0
V 58.3 ± 1.9 (55.5–59.5) 64 64(61–66) 59–64 57–63 58–66
Stylet length 28.8 ± 0.94 (28.2–30.7) 30 30 (28–30) 31–33 28–33 27–33.5
Pharyngal length 135.1 ± 11.6 (120.2–152.7) 150–175 103–140
Max. body diam.a 35.4 ± 2.9 (30.3–38.9) 26–37
Tail length 16.2 ± 3.1 (11.3–20.5) 12–16 15–22 13–19 12–22
Anal body diameter 17.9 ± 2.34 (13.3–20.3)
Tail annuli number 13.2 ± 2.5 (10.0–16.0) 8–12 8–12 6–12
Phasmid position (number of annules anterior to anus) 5.0±2.7 (3.0-9.0) 4–9 6–12 3–12
eISSN:
2640-396X
Language:
English
Publication timeframe:
Volume Open
Journal Subjects:
Life Sciences, other