RhD-mediated hemolytic disease of the fetus and newborn (HDFN), although of much lower incidence than in the 1960s, continues to pose a serious risk for the fetus or neonate.1, 2, 3, 4, 5 HDFN caused by anti-D can also occur, when mothers carry variant RhD proteins.6, 7, 8, 9, 10, 11 Recent work group recommendations advocate the use of
The clinically relevant DAR1.2 (weak D 4.2.2) phenotype encoded by the
The weak D type 19 phenotype encoded by
We report a woman with a serologic weak D phenotype harboring a novel allele
A 30-year-old African American female patient (gravida 0) presented for infertility treatment. She had polycystic ovary syndrome, endometriosis, galactorrhea, prolactinoma, dysmenorrhea, and a long-standing history of metrorrhagia. She had previously received 3 group A, D+ RBC units due to symptomatic anemia with syncope. At an outside hospital, a robotic-assisted metroplasty to correct uterus didelphys was performed, at which time she was typed as group AB, D+. She was enrolled 9 months later in the National Institutes of Health clinical protocol 99-CH-0103 for “Evaluation of Women and Men with Endocrine and Reproductive-Related Conditions” and scheduled for a diagnostic laparoscopy, chromopertubation and endometrial biopsy, and dilation and curettage followed by operative hysteroscopy.
Blood grouping showed AB with a possible subgroup of A, a serologic weak D phenotype, and a negative antibody detection test. In forward grouping, the agglutination strength of A antigen was 3+, weaker than B (4+), but showed a mixed-field agglutination pattern. Anti-A1 lectin testing was negative, as was the reverse grouping with A1, B, and A2 reagent RBCs. For routine care, the patient was noted to receive group AB RBCs.
The patient showed no agglutination with anti-D at immediate spin via tube method but showed 3+ agglutination via the gel matrix method. Weak D testing with antihuman globulin showed 2+ agglutination (tube). Thus, testing reproducibly confirmed a serologic weak D phenotype (Table 1). Following our standard operating procedure, molecular screening of the patient’s
Routine serology
Test | Result |
---|---|
ABO group | AB (mixed-field agglutination for A)* |
RhD phenotype | Serologic weak D phenotype† |
RhCE phenotype | C+E–c+e+ |
Antibody detection test | Negative |
Direct antiglobulin test | Negative |
*Anti-A1 negative. Molecular characterization consistent with A2B phenotype.
† D typing in tube agglutination using a routine oligoclonal anti-D blend (BS232, BS221, and H41 11B7; Bio-Rad, Hercules, CA) was negative in immediate spin but 2+ positive with antihuman globulin (AHG). D typing in gel matrix method (clone MS-201) with AHG was 3+ positive.
The procedure was uneventful, without the need for blood transfusion. Subsequently, an extended molecular workup was performed that documented an A2B subgroup and confirmed a suspected novel
Immediate spin test and indirect antiglobulin test were performed as per our standard operating procedure by standard tube and gel matrix methods with licensed reagents (Ortho Clinical Diagnostics, Raritan, NJ, and Bio‑Rad Laboratories, Feldkirchen, Germany) and 13 monoclonal anti-D reagents (Advanced Partial RhD Typing Kit and RhD Variant Investigation Kit; Alba Bioscience/Quotient, Eysins, Switzerland).
To characterize the
To characterize the
Because of lack of fresh whole blood for mRNA isolation, allele-specific amplification of genomic DNA and sequencing was performed to separate and identify the two
rf4-6ds: TAAGCTCTGAACACCAGTCTCA (forward)27 located in
RHD_3RC: CCTGAGATGGCTGTCACCA
RHD_3RT: CCTGAGATGGCTGTCACCA
These primers targeted the wild-type and variant nucleotides of 744C>T substitution (underlined) in
In routine serology, the patient typed as group AB with mixed-field agglutination for A. She also typed as a serologic weak D phenotype (Table 1). Her Rh phenotype was C+E– c+e+.
Sequencing of all seven exons of the
Using the RBC-FluoGene D weak/variant kit in routine care, the nucleotide c.602G was detected, which can indicate a
Red cell genotyping of the
Test | Allele 1 | Allele 2 |
---|---|---|
RBC-FluoGene D weak/variant | Possible |
|
wRHD BeadChip | Possible |
|
Nucleotide sequencing | ||
Allele recognized | Known | Novel |
Nucleotide sequence (GenBank) | KF712273 | MT980847 |
Amino acid change(s) | T201R, F223V, I342T | I204K |
Serologic weak D phenotype15 | DAR1.2 (weak D 4.2.2)18 | Weak D type 161 |
ISBT terminology16 |
†ClinVar SCV001977615.
We tested the strength of the D antigen expressed on the patient’s RBCs. Except for LHM57/17, the remaining 12 monoclonal anti-D reagents30 agglutinated the RBCs with varying reaction strengths (Table 3). Blood samples from individuals hemizygous for weak D type 45 (GenBank AJ867388), weak D type 64 (GenBank AM902713), and weak D type 88 (GenBank LN612637) alleles were tested in parallel with the patient’s RBCs (Table 3). For comparison, the same RBC samples were also tested in immediate spin in tube and gel matrix (Table 4).
Serologic testing with panels of anti-D
D variant and serologic reaction strength* |
|||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Study sample |
Control samples |
||||||||||||
Monoclonal anti-D† |
Weak D type |
||||||||||||
Clone | Isotype | epD | Patient CDe/cDe | 19‡ CDe/cde | 1 CDe/cde | 4.0§ cDe/cde | 4.1 cDe/cde | 4.2.2¶ cDe/cde | 45 CDe/cde | 64 cDe/cde | 88 cDE/cde | D+ cDe/cde | D– cde/cde |
LHM76/58 | IgG1λ | 8.1 | 4+ | + | 4+ | 4+ | 4+ | 3+ to 4+ | 4+ | 4+ | 4+ | 4+ | 0 |
LHM76/59 | IgG1 | 15.1 | 4+ | + | 4+ | 4+ | 4+ | 3+ to 4+ | 4+ | 4+ | 4+ | 4+ | 0 |
LHM174/102 | IgG3κ | 1.2 | 2+ | + | 0 | 0 | 0 | 0 | 4+ | 2+ | 1+ | 4+ | 0 |
LHM50/2B | IgG1λ | 6.3 | 4+ | NT | 4+ | 4+ | 4+ | 3+ to 4+ | 4+ | 4+ | 4+ | 4+ | 0 |
LHM169/81 | IgG3κ | 1.1 | 4+ | + | 4+ | 4+ | 4+ | 2+ to 3+ | 4+ | 4+ | 4+ | 4+ | 0 |
ESD1 | IgG1κ | 4.1 | 4+ | NT | 4+ | 4+ | 4+ | 3+ to 4+ | 4+ | 4+ | 4+ | 4+ | 0 |
LHM76/55 | IgG1κ | 3.1 | 4+ | + | 4+ | 4+ | 4+ | 3+ to 4+ | 4+ | 4+ | 4+ | 4+ | 0 |
LHM77/64 | IgG1κ | 9.1 | 4+ | NT | 4+ | 4+ | 4+ | 3+ to 4+ | 4+ | 4+ | 4+ | 4+ | 0 |
LHM70/45 | IgG1λ | 1.2 | 3+ | + | 3+ | 3+ | 3+ | 0 to 2+ | 3+ | 3+ | 3+ | 4+ | 0 |
LHM59/19 | IgG3κ | 8.1 | 4+ | NT | 3+ | 3+ | 3+ | 0 to 2+ | 4+ | 3+ | 3+ | 4+ | 0 |
LHM169/80 | IgG3λ | 6.3 | 4+ | NT | 4+ | 4+ | 4+ | 3+ to 4+ | 4+ | 4+ | 4+ | 4+ | 0 |
LHM57/17 | IgG1λ | 6.3 | 0 | NT | 0 | 0 | 0 | 0 to 2+ | NT | 0 | 0 | 1+ | 0 |
LDM1 | IgM | 6.5 | 3+ | NT | 0 | 4+ | 3+ | 0 to 2+ | 4+ | 0 | 2+ | 4+ | 0 |
*Gel matrix test with antihuman globulin.
†ALBAclone Advanced Partial RhD typing kit (recently renamed as ALBAclone RhD Variant Investigation kit) (Alba Bioscience/Quotient, Eysins, Switzerland).
‡Results from Yu et al.23
§Two samples tested.
¶Four samples tested.
NT = not tested.
Immediate spin testing
Samples | |||||||||
---|---|---|---|---|---|---|---|---|---|
Study sample |
Control samples |
||||||||
Weak D type |
|||||||||
Test method* | Patient CDe/cDe | 4.0† cDe/cde | 4.1 cDe/cde | 4.2.2‡ cDe/cde | 45 CDe/cde | 64 cDe/cde | 88 cDE/cde | D+ cDe/cde | D– cde/cde |
Tube | 0 | 2+ | 1+ | 0 | 2+ | 0 | 0 | 3+ | 0 |
Gel matrix | 3+ | 3+ | 3+ | 1+ to 3+ | 4+ | 3+ | 3+ | 4+ | 0 |
* For the tube testing, clones BS232 (IgM, epD 6.4), BS221 (IgG, epD 6.3), and H41 11B7 (IgG, epD 3.1) were used, and for gel matrix testing, clone MS-201 (IgM, epD 6.1) was used. Per test principle, all immediate spin tests are performed without antihuman globulin.
†Two samples tested.
‡Four samples tested.
The name
This clinical report illustrates the application of red cell genotyping in routine clinical care. The patient was compound heterozygous for two different variant
The African American female patient presented for routine serology testing in preparation for surgery. Initial serologic workup indicated her RBCs to be group AB with mixed-field agglutination for A and a weak D phenotype due to a lack of D reactivity at immediate spin. The concurrent occurrence of variants for both ABO and Rh antigens is rare and can mimic a two-cell population, such as in chimera32, 33 and mosaicism.34, 35 Per standard operating procedure, we apply red cell genotyping for all serologic weak D phenotypes to determine the specific causal
Once her molecular weak D type was confirmed, we addressed the mixed-field agglutination by
The
We routinely perform nucleotide sequencing for clinical purposes when discrepancy with published data such as
Anti-D immunization rates can surpass 50 percent in many clinically relevant situations.43 However, despite previous multiple D+ transfusions, no anti-D immunization had occurred in the current patient. The lack of such observations is relevant, particularly if documented for larger cohorts.13 It may be possible in the future that the vast majority of patients with most of the more than 161 molecular weak D types, including the patient presented here, can safely be treated as D+.17 Current recommendations do not support such a policy, but they may be revised based on forthcoming clinical evidence, which hence needs to be published.
The amino acid position p.204 is located in the RBC membrane near the intracellular region of the RhD protein44 and is associated with two variant alleles. The wild-type RhD protein has a non-polar isoleucine, which is replaced with the polar but uncharged amino acid threonine (p.I204T or Ile204Thr) in the known
Both weak D type 19 (p.Ile204Thr) and the DAR1 (weak D 4.2)18 (p.Thr201Arg, p.Phe223Val, p.Ile342Thr) express significantly reduced D antigen densities of 272123 and 1650,19 respectively. The DAR1.2 (weak D 4.2.2) lacks certain RhD epitopes and may test negative with clones LHM174/102, LHM70/45, LHM59/19, and LDM1 (Table 3).28 However, these four anti-D reagents agglutinated the patient’s RBCs. Based on this reactivity pattern, we concluded that the novel weak D type 161, despite occurring
The weak D type 19 types as a D antigen of normal strength by routine serology, while the DAR1 (weak D 4.2) is known to give disparate results in the immediate spin test as shown before50 and also in the current study (Table 4). Weak D alleles are typically observed in isolated form in individuals known as hemizygotes with only one copy of the variant
The present clinical report illustrates the advantage of molecular methods to identify novel or known
The encounter of most rare alleles and novel alleles is expected to yield inconclusive results as exemplified in the current case study by discrepancies in
Visit the new Web site to view abstracts of all published articles, read a selected article in Open Access format, review announcements of upcoming events, and view ongoing laboratory advertisements.
E-mail information to