The urinary tract infections (UTIs) caused by various
In Egypt, the contribution of
Aminoglycosides are natural or semisynthetic antimicrobials and are one of the first agents to be used for routine clinical practice (Krause et al. 2016). They are bactericidal agents exerting their effect during the translation process through the interference with the correct decoding of the mRNA (Chiem et al. 2016). They are active against Gram-negative bacteria like
Over the past decades, substantial attempts have been made to explore novel antimicrobial activities of aminoglycosides, for example, their antifungal effect (Lu et al. 2018). However, until now, the data concerning the enhancement of conventional antifungal agents’ activity in combination with amikacin against
The current study aimed at the investigation of the activity of amikacin against
All isolates were preserved as frozen stocks in 15% glycerol at –20°C. A fresh culture was obtained by subculturing the isolates on Sabouraud dextrose agar (SDA) (LAB M, UK) for 48 h at 37°C before use.
Sequences of primers for the genes selected for transcript analysis using quantitative RT-PCR.
Gene | Orientation | Sequence (5′–3′) | Reference |
---|---|---|---|
|
F | TTGGTGATGAAGCCCAATCC | Chau et al. 2004 |
R | CATATCGTCCCAGTTGGAAACA | ||
|
F | TTACCTGAAACTTTTGGCAAAACA | Chau et al. 2004 |
R | ACTTGTGATTCTGTCGTTACCG | ||
|
F | TTTAGCCAGAACTTTCACTCATGATT | Chau et al. 2004 |
R | TATTTATTTCTTCATGTTCATATGGATTGA | ||
|
F | GGTATTGGCTGGTCCTAATGTGA | Chau et al. 2004 |
R | GCTTGAATCAAATAAGTGAATGGATTAC |
Using the TOPreal™ One step RT qPCR Kit (Enzynomics), the step of reverse transcription was accomplished. The composition of the real-time PCR mixture was as follows: 1 μl of TOPreal™ One step RT qPCR Enzyme Mix, 10 μl of 2X TOPreal™ One step RT qPCR Reaction Mix, 1 μl of each primer, 1 μl of total RNA, and sterile DNase-free water to reach to a total reaction volume of 20 μl.
After applying a preliminary holding step at 50°C for 30 min, the cycling conditions for the PCR reaction were as follows: an initial denaturation step at 95°C for 10 min, then 40 cycles of denaturation at 95°C for 5 sec, followed by annealing/extension at 60°C for 30 sec. In every RT-PCR run, negative control containing sterile DNase-free water instead of the RNA template was involved. Samples were tested in triplicate.
To ensure the absence of the primer-dimers or any other artifacts, analysis of the melting curves was done in one cycle of 94°C, 53°C and 94°C, one minute each. The amplification curves, as well as the values of the cycle threshold (Ct) were established using the Stratagene MX3005P software.
The levels of the expression of each of the
Demographic profile of candiduric patients.
Demographic variables | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Sex | Age group (years) | |||||||||||
Male | Female | 30–40 | 41–50 | 51–60 | 61– > 70 | |||||||
n | % | n | % | n | % | n | % | n | % | n | % | |
|
11 | 61.1 | 7 | 38.9 | 0 | 0 | 6 | 33.3 | 1 | 5.6 | 11 | 61.1 |
Non-albicans |
5 | 50 | 5 | 50 | 1 | 10 | 3 | 30 | 1 | 10 | 5 | 50 |
Total (n = 28) | 16 | 57.1 | 12 | 42.9 | 1 | 3.6 | 9 | 32.1 | 2 | 7.1 | 16 | 57.1 |
Identification, virulence determinants, and the minimum inhibitory concentration (MIC) of fluconazole against the
Isolate code | Candida species | Virulence determinants | MIC of Fluconazole (μg/ml) c | ||
---|---|---|---|---|---|
Biofilm formation | Proteases production Pz value a | Phospholipase production Pz value b | |||
C1 |
|
Strong | 0.26 | 0.33 | 128 |
C2 |
|
Strong | 0.4 | 0.48 | 16 |
C3 |
|
Strong | 0.16 | 0.29 | 8 |
C4 |
|
Strong | 0.19 | 0.29 | 32 |
C5 |
|
Strong | 0.2 | 1 | 8 |
C6 |
|
Strong | 0.2 | 0.3 | 1024 |
C7 |
|
Strong | 0.22 | 0.23 | 128 |
C8 |
|
Weak | 0.18 | 0.21 | 1024 |
C9 |
|
Weak | 0.67 | 0.22 | 1024 |
C10 |
|
Moderate | 0.5 | 0.2 | 32 |
C11 |
|
Strong | 0.26 | 0.26 | 16 |
C12 |
|
Moderate | 0.43 | 0.23 | 32 |
C13 |
|
Strong | 0.4 | 0.2 | 8 |
C14 |
|
Strong | 0.26 | 0.3 | 256 |
C15 |
|
Strong | 0.24 | 0.24 | 16 |
C16 |
|
Strong | 0.24 | 0.24 | 8 |
C17 |
|
Strong | 0.15 | 0.27 | 1024 |
C18 |
|
Moderate | 0.25 | 0.21 | 8 |
C19 |
|
Weak | 0.15 | 0.67 | 2 |
C20 |
|
Strong | 0.14 | 0.31 | 1024 |
C21 |
|
Strong | 0.17 | 0.4 | 1024 |
C22 |
|
Weak | 0.15 | 0.39 | 1 |
C23 |
|
Strong | 0.18 | 0.32 | 1024 |
C24 |
|
Strong | 0.17 | 0.41 | 8 |
C25 |
|
Weak | 0.17 | 0.23 | 8 |
C26 |
|
Moderate | 0.2 | 0.16 | 256 |
C27 |
|
Strong | 0.16 | 0.32 | 16 |
C28 |
|
Strong | 0.16 | 0.4 | 128 |
The Pz (precipitation zone) value: 1 (negative), 0.75–0.9 (low producers), 0.51–0.74 (moderate producers) and 0.35–0.5 (high producers)
The Pz value: 1 (negative), < 1 – > 0.63 (moderate), and < 0.63 (strong)
CLSI breakpoint for fluconazole is 64 μg/ml
Fluconazole susceptibility of different
Candida species | Fluconazole susceptibility n (%) | MIC50 | MIC90 | MIC range (μg/ml) | |
---|---|---|---|---|---|
S | R | ||||
|
12 (66.7%) | 6 (33.3%) | 16 | 1024 | 1–1024 |
Non-albicans |
4 (40%) | 6 (60%) | 128 | 1024 | 8–1024 |
|
4 (57.1%) a | 3 (42.9%) | 32 | 1024 | 8–1024 |
|
0 (0%) a | 2 (100%) | 128 b | ND c | ND |
|
0 (0%) a | 1 (100%) | ND | ND | ND |
The percentage was calculated relative to the total number of non-albicans
MIC50 is calculated here as the arithmetic mean of the MIC values for both
ND – not determined
Production of proteinase enzymes was high among 27 isolates (96.4% of the tested isolates), among which 11 isolates (40.7%) were resistant to fluconazole. These high producers of proteinases were classified as 18
A total of 26/28 isolates (92.9%) were strong producers of phospholipase, out of which 12 isolates (46.2%) were resistant to fluconazole. One isolate was a moderate producer, while the second showed a negative result for phospholipase production. Both isolates were fluconazole-susceptible
Resistance-modulating effect of amikacin (4000 μg/ml) on fluconazole-resistant
Isolate code | Candida species | MIC of fluconazole alone (μg/ml) | MIC of fluconazole (μg/ml) in the presence of amikacin | Modulation factor (MF) a |
---|---|---|---|---|
C1 |
|
128 | 4 | 32 |
C6 |
|
1024 | 4 | 256 |
C7 |
|
128 | 4 | 32 |
C8 |
|
1024 | 32 | 32 |
C9 |
|
1024 | 32 | 32 |
C14 |
|
256 | 4 | 64 |
C17 |
|
1024 | 4 | 256 |
C20 |
|
1024 | 4 | 256 |
C21 |
|
1024 | 4 | 256 |
C23 |
|
1024 | 4 | 256 |
C26 |
|
256 | 256 | 1 |
C28 |
|
128 | 4 | 32 |
Modulation factor (MF) was calculated as MICfluconazole alone/MICfluconazole + amikacin
Inhibitory effect of amikacin (4,000 μg/ml) on the efflux of rhodamine in fluconazole-resistant
Inhibitory effect of amikacin (4,000 μg/ml) on the efflux of rhodamine in fluconazole-resistant
Inhibitory effect of amikacin (4,000 μg/ml) on the efflux of rhodamine in fluconazole-resistant
Comparing the effect of amikacin (4,000 μg/ml) on the efflux of rhodamine among the three tested isolates C6, C8, and C21 after 120 minutes of treatment, a statistically significant effect (
Percentage of reduction in the rhodamine fluorescence intensity after 120 minutes of amikacin (4,000 μg/ml) treatment of C6, C21 and C8
The downregulatory effect of amikacin on the expression of the efflux pump genes of isolate C6 was exerted most prominently on the gene
Relative gene expression levels of the efflux pump mediated genes
Aggravating the problem is the fact of the dissemination of resistance among urinary
The observed fluconazole resistance in
Since the treatment of candiduric patients infected with fluconazole-resistant
Further confirmation on the sensitizing effect of amikacin was investigated by quantifying the gene expression level of three genes responsible for the fluconazole efflux which are CDR1, CDR2 (belonging to ATP-binding cassette, ABC transporter), and MDR1 (a member of major facilitator superfamily, MFS). It was done using the quantitative RT-PCR for two selected fluconazole-resistant