<abstract xmlns="http://www.w3.org/1999/xhtml">

<sec id="j_jvetres-2022-0029_s_005">
<h3>Introduction</h3>
<p>It has been suggested that coagulase-negative staphylococci can serve as reservoirs of virulence genes for other bacteria. This study assessed the presence of such genes in selected isolates recovered from meat of the giant African snail (<italic>Achatina achatina</italic>).</p>
</sec>
<sec id="j_jvetres-2022-0029_s_006">
<h3>Material and Methods</h3>
<p>Virulence genes were detected using a polymerase chain reaction targeting specific primers. Two representative isolates were identified using 16S rRNA gene sequencing.</p>
</sec>
<sec id="j_jvetres-2022-0029_s_007">
<h3>Results</h3>
<p>The results showed that the staphylococcal enterotoxin A gene (<italic>sea</italic>) was present in five out of the eight isolates studied. The isolates expressed resistance mainly to three antibiotics: chloramphenicol, norfloxacin and cloxacillin in descending order of incidence. Most importantly, the <italic>Staphylococcus sciuri</italic> isolate NEDU 181, in addition to being resistant to the three aforementioned antibiotics, also harboured the <italic>sea</italic> gene.</p>
</sec>
<sec id="j_jvetres-2022-0029_s_008">
<h3>Conclusion</h3>
<p>Our findings demonstrate, for the first time, the presence of toxigenic and antibiotic-resistant coagulase-negative <italic>Staphylococcu</italic>s spp. in commercially-available fresh snail meat. With staphylococcal enterotoxin A known to survive cooking temperature, this presents a food safety concern.</p>
</sec>

</abstract>

Introduction
It has been suggested that coagulase-negative staphylococci can serve as reservoirs of virulence genes for other bacteria. This study assessed the presence of such genes in selected isolates recovered from meat of the giant African snail (Achatina achatina).


Material and Methods
Virulence genes were detected using a polymerase chain reaction targeting specific primers. Two representative isolates were identified using 16S rRNA gene sequencing.


Results
The results showed that the staphylococcal enterotoxin A gene (sea) was present in five out of the eight isolates studied. The isolates expressed resistance mainly to three antibiotics: chloramphenicol, norfloxacin and cloxacillin in descending order of incidence. Most importantly, the Staphylococcus sciuri isolate NEDU 181, in addition to being resistant to the three aforementioned antibiotics, also harboured the sea gene.


Conclusion
Our findings demonstrate, for the first time, the presence of toxigenic and antibiotic-resistant coagulase-negative Staphylococcus spp. in commercially-available fresh snail meat. With staphylococcal enterotoxin A known to survive cooking temperature, this presents a food safety concern.

First report of the presence of enterotoxin gene in coagulase-negative staphylococci recovered from meat of snails (<italic>Achatina achatina</italic>)

Journal of Veterinary Research

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

First report of the presence of enterotoxin gene in coagulase-negative staphylococci recovered from meat of snails ()

Introduction
It has been suggested that coagulase-negative staphylococci can serve as reservoirs of virulence genes for other bacteria. This study assessed the...

Isolate code	Cloxacillin	Chloramphenicol	Norfloxacin	Haemolysin	Gelatinase	Lecithinase	Sea gene	Exhc gene
0180 EN	S	R	R	+	+	+	–	–
0181 EN	R	R	R	+	+	+	+	–
0182 EN	R	S	S	+	+	+	+	–
0183 EN	S	R	S	+	+	+	+	–
0184 EN	S	S	R	+	+	+	–	–
0185 EN	S	S	S	+	+	+	+	–
0186 EN	S	S	S	+	+	+	–	–
0187 EN	S	R	S	+	+	+	+	–

Target gene	Primer sequence (5ʹ–3ʹ)	Amplicon size (Base pairs)	Reference
	F: TAA GGA GGT GGT GCC TAT GG
Sea	R: CAT CGA AAC CAG CCA AAG TT	180	(19)
Exhc	F: GAATAAATATTATGGAGTCTCTCCTGATC
Exhc	R: CCATAGTATTTCAATCCAAAATCAGTAC	525	(14)

First report of the presence of enterotoxin gene in coagulase-negative staphylococci recovered from meat of snails (Achatina achatina)

Online veröffentlicht: 07. Juni 2022

Seitenbereich: 161 - 165

Eingereicht: 11. Jan. 2022

Akzeptiert: 27. Mai 2022

DOI: https://doi.org/10.2478/jvetres-2022-0029

Schlüsselwörter
fresh snail meat, 16S rRNA gene, gene, antibiotic resistance

© 2022 A.C. Okafor et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Antibiotic resistance and some virulence factors in coagulase-negative Staphylococcus spp. isolated from edible snails

Primers used for the detection of two virulent genes in coagulase-negative Staphylococcus recovered from edible snails

First report of the presence of enterotoxin gene in coagulase-negative staphylococci recovered from meat of snails (Achatina achatina)

Online veröffentlicht: 07. Juni 2022

Seitenbereich: 161 - 165

Eingereicht: 11. Jan. 2022

Akzeptiert: 27. Mai 2022

DOI: https://doi.org/10.2478/jvetres-2022-0029

Schlüsselwörterfresh snail meat, 16S rRNA gene, gene, antibiotic resistance

© 2022 A.C. Okafor et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Antibiotic resistance and some virulence factors in coagulase-negative Staphylococcus spp. isolated from edible snails

Primers used for the detection of two virulent genes in coagulase-negative Staphylococcus recovered from edible snails

Schlüsselwörter
fresh snail meat, 16S rRNA gene, gene, antibiotic resistance