<abstract xmlns="http://www.w3.org/1999/xhtml">

<sec id="j_jvetres-2020-0009_s_005">
<h3>Introduction</h3>
<p>Marek’s disease virus (MDV) can cause malignant T-cell lymphomas and immunosuppression in chickens. Macrophage migration inhibitory factor (MIF) not only plays a critical role in inhibiting T-cell responses, but also contributes to multiple aspects of tumour progression. The aim of this study was to reveal the potential role of MIF in the pathogenesis of MDV infection.</p>
</sec>
<sec id="j_jvetres-2020-0009_s_006">
<h3>Material and Methods</h3>
<p>MIF gene expression levels were measured by using real-time PCR. Expression was assayed at different times in chicken embryo fibroblast (CEF) cells and tissue samples of SPF chickens infected with different MDV strains and fold change was calculated by the 2<sup>–△△CT</sup> method.</p>
</sec>
<sec id="j_jvetres-2020-0009_s_007">
<h3>Results</h3>
<p>The expression of MIF was significantly downregulated (p &lt; 0.05 and FC > 2) in CEF cells infected with the very virulent MDV RB1B strain at 48 h post infection (hpi) and in the skin and spleen at 14 days post infection (dpi). The reduction of MIF expression was also found in CEF cells infected by reticuloendotheliosis virus (REV), avian leukosis virus subgroup J (ALV-J), and MDV vaccine strain CVI988 or in HD11 cells stimulated with TLR2, 3, 4, and 7 ligands. Interestingly, MIF expression decreased continuously from 7 to 28 dpi in the thymus after RB1B virus infection while it increased after CVI988 virus infection. Upregulated expression of MIF was found in CEF infected with RB1B at 96 hpi and in the spleen and skin at 21 and 28 dpi.</p>
</sec>
<sec id="j_jvetres-2020-0009_s_008">
<h3>Conclusion</h3>
<p>The present study revealed the different expression pattern of MIF in response to MDV infection and indicated that MIF level may be associated with MDV pathogenesis.</p>
</sec>
</abstract>

Introduction
Marek’s disease virus (MDV) can cause malignant T-cell lymphomas and immunosuppression in chickens. Macrophage migration inhibitory factor (MIF) not only plays a critical role in inhibiting T-cell responses, but also contributes to multiple aspects of tumour progression. The aim of this study was to reveal the potential role of MIF in the pathogenesis of MDV infection.


Material and Methods
MIF gene expression levels were measured by using real-time PCR. Expression was assayed at different times in chicken embryo fibroblast (CEF) cells and tissue samples of SPF chickens infected with different MDV strains and fold change was calculated by the 2–△△CT method.


Results
The expression of MIF was significantly downregulated (p < 0.05 and FC > 2) in CEF cells infected with the very virulent MDV RB1B strain at 48 h post infection (hpi) and in the skin and spleen at 14 days post infection (dpi). The reduction of MIF expression was also found in CEF cells infected by reticuloendotheliosis virus (REV), avian leukosis virus subgroup J (ALV-J), and MDV vaccine strain CVI988 or in HD11 cells stimulated with TLR2, 3, 4, and 7 ligands. Interestingly, MIF expression decreased continuously from 7 to 28 dpi in the thymus after RB1B virus infection while it increased after CVI988 virus infection. Upregulated expression of MIF was found in CEF infected with RB1B at 96 hpi and in the spleen and skin at 21 and 28 dpi.


Conclusion
The present study revealed the different expression pattern of MIF in response to MDV infection and indicated that MIF level may be associated with MDV pathogenesis.

Potential role of macrophage migration inhibitory factor in the pathogenesis of Marek’s disease

Journal of Veterinary Research

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Introduction
Marek’s disease virus (MDV) can cause malignant T-cell lymphomas and immunosuppression in chickens. Macrophage migration inhibitory factor (MIF) not only plays a critical role in inhibiting T-cell responses, but also contributes to multiple aspects of tumour progression. The aim of this study was to reveal the potential role of MIF in the pathogenesis of MDV infection.


Material and Methods
MIF gene expression levels were measured by using real-time PCR. Expression was assayed at different times in chicken embryo fibroblast (CEF) cells and tissue samples of SPF chickens infected with different MDV strains and fold change was calculated by the 2–△△CT method.


Results
The expression of MIF was significantly downregulated (p  2) in CEF cells infected with the very virulent MDV RB1B strain at 48 h post infection (hpi) and in the skin and spleen at 14 days post infection (dpi). The reduction of MIF expression was also found in CEF cells infected by reticuloendotheliosis virus (REV), avian leukosis virus subgroup J (ALV-J), and MDV vaccine strain CVI988 or in HD11 cells stimulated with TLR2, 3, 4, and 7 ligands. Interestingly, MIF expression decreased continuously from 7 to 28 dpi in the thymus after RB1B virus infection while it increased after CVI988 virus infection. Upregulated expression of MIF was found in CEF infected with RB1B at 96 hpi and in the spleen and skin at 21 and 28 dpi.


Conclusion
The present study revealed the different expression pattern of MIF in response to MDV infection and indicated that MIF level may be associated with MDV pathogenesis.

Introduction
Marek’s disease virus (MDV) can cause malignant T-cell lymphomas and immunosuppression in chickens. Macrophage migration inhibitory factor (MIF)...

Gene	Primer Sequence (5′–3′)	Product size (bp)	Accession number
MIF	F: GCCCGCGCAGTACATAGC R: CCCCCGAAGGACATCATCT	57	XM42_5824
GAPDH	F: AGGGTGGTGCTAAGCGTGTTA R: TCTCATGGTTGACACCCATCA	78	NM_204305
18S rRNA	F: TCAGATACCGTCGTAGTTCC R: TTCCGTCAATTCCTTTAAGTT	154	AF173612

Potential role of macrophage migration inhibitory factor in the pathogenesis of Marek’s disease

Online veröffentlicht: 31. Jan. 2020

Seitenbereich: 33 - 38

Eingereicht: 09. Juli 2019

Akzeptiert: 20. Jan. 2020

DOI: https://doi.org/10.2478/jvetres-2020-0009

Schlüsselwörter
Marek’s disease virus, macrophage migration inhibitory factor, chicken embryo fibroblasts, pathogenesis

© 2020 Z. Fan et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Fig. 2

Primers used for real-time PCR

Potential role of macrophage migration inhibitory factor in the pathogenesis of Marek’s disease

Online veröffentlicht: 31. Jan. 2020

Seitenbereich: 33 - 38

Eingereicht: 09. Juli 2019

Akzeptiert: 20. Jan. 2020

DOI: https://doi.org/10.2478/jvetres-2020-0009

SchlüsselwörterMarek’s disease virus, macrophage migration inhibitory factor, chicken embryo fibroblasts, pathogenesis

© 2020 Z. Fan et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Fig. 2

Primers used for real-time PCR

Schlüsselwörter
Marek’s disease virus, macrophage migration inhibitory factor, chicken embryo fibroblasts, pathogenesis