Marek’s disease (MD) is a lymphoproliferative disease of birds caused by a highly oncogenic, cell-associated α-herpesvirus termed Marek’s disease virus (MDV) (3). This virus can cause malignant T-cell lymphomas and immunosuppression in chickens. The primary target cells for virus infection in the chicken are B lymphocytes. The virus destroys the cells in a few days after infection and then enters a latent phase. During latent infection of activated T cells, expressed genes are low in abundance, but the virus can be obtained from the lymphocytes (21). These latently infected T lymphocytes are the means of virus dissemination to the skin and feather follicle epithelial cells. Toll-like receptors (TLRs) have key roles in the recognition of pathogens and the initiation of the innate immune response that subsequently primes the specific adaptive immune response during infection. In addition, the activation of TLRs not only has implications for antiviral defence but also contributes to tumour suppression. Increased expression of TLR2, TLR3, TLR4, and TLR7 was found in MDV-infected chicken tissues (10).
Macrophage migration inhibitory factor (MIF) is a classic pro-inflammatory cytokine secreted by several cell types, including activated T lymphocytes and macrophages, and plays a central role in the control of the host inflammatory and immune response (4). MIF was initially described as a soluble mediator secreted by activated T cells that inhibits the migration of macrophages. MIF antibody treatment has been shown to elicit a significant increase in cytotoxic T lymphocyte (CTL) response, as well as increased levels of interferon gamma (IFN-γ) expression (1). MIF not only plays a critical role in inhibiting T-cell responses but also contributes to multiple aspects of tumour progression through modulating several important biological mechanisms and processes (19). In addition, mounting evidence suggests that inflammation is closely associated with many types of cancer and MIF is a potent molecular link between inflammation and cancer (16). Moreover, MIF antibody treatment effectively suppressed tumour growth and tumour-associated angiogenesis (23). Taken together, these actions of MIF define it as important for the development and progression of cancer and render it exploitable as a marker for tumour detection.
In the previous study, MIF was identified as a differentially expressed protein in chicken thymus infected with the very virulent MDV RB1B strain, suggesting this protein might be involved in the pathogenesis of Marek’s disease in poultry (9). Functional characterisation of avian MIF demonstrated the inhibition of macrophage migration, similarly to mammalian MIF, and the mediation of inflammatory responses during antigenic stimulation (12). However, there was no further investigation of its role in the pathogenesis of MDV infection or tumour progression in birds, and little is known about whether MIF is associated with the TLR-mediated immune response. In this study, we explore the potential role of MIF in the pathogenesis of MDV and make an attempt to identify the areas where knowledge is lacking in this field.
Primary chicken embryo fibroblast (CEF) cells were prepared by standard methods from ten-day-old SPF embryos. The cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% foetal bovine serum (FBS) and antibiotics (100 U/mL of penicillin and 100 U/mL of streptomycin, Gibco) and were incubated at 37°C in 5% CO2 for 24 h. After incubation, secondary CEF was used for virus infection. HD11, an avian macrophage cell line, was cultured in RPMI 1640 medium (Gibco) supplemented with 10% FBS, 10% tryptose phosphate broth (Sigma-Aldrich, St. Louis, MO, USA) and antibiotics (100 U/mL of penicillin and 100 U/mL of streptomycin, Gibco) at 41°C, 5% CO2 and 95% humidity.
Primers used for real-time PCR
Gene | Primer Sequence (5′–3′) | Product size (bp) | Accession number |
---|---|---|---|
MIF | F: GCCCGCGCAGTACATAGC R: CCCCCGAAGGACATCATCT |
57 | XM42_5824 |
GAPDH | F: AGGGTGGTGCTAAGCGTGTTA R: TCTCATGGTTGACACCCATCA |
78 | NM_204305 |
18S rRNA | F: TCAGATACCGTCGTAGTTCC R: TTCCGTCAATTCCTTTAAGTT |
154 | AF173612 |
MIF expression in CEF and HD11 cells. A – expression of MIF in CEF cells infected with RB1B or CVI988 strain; B – expression of MIF in chicken fibroblasts infected with REV or ALV-J; C – expression of MIF in HD11 in response to TLR2 and four stimulations; D – expression of MIF in CEF in response to TLR3 and TLR7 stimulations. The different number of asterisks (*) indicates statistically significant difference for the comparison of control (uninfected or untreated) and infected (or stimulated) transcripts at the same time point as determined by Student’s
MIF expression in chicken skin infected with RB1B or CVI988 strain. The different number of asterisks (*) indicates statistically significant difference for the comparison of control (uninfected) and infected transcripts at the same time point as determined by Student’s
Despite our knowledge of molecular and cellular mechanisms of immunity against MD, we still have a limited understanding of the process and dynamics of T-cell mediated responses to the virus. Moreover, significant information on critical aspects of virus latency in lymphoid cells and the virus-host interaction in MDV-induced lymphoma is lacking. Importantly, there is little known about the molecular determinants of the host which govern T-lymphocyte immune response and transformation in latent MDV infection. T-lymphocytes are of key importance to the immune system and are at the core of adaptive immunity, thus the virus is not sufficient by itself for induction of T-cell lymphomas and the regulatory mechanisms of T-cell immunity could be employed by MDV. Reports showed that MDV influences the expression of genes associated with T lymphocyte responses during MDV infection (13). MIF plays a critical role in inhibiting T-cell responses, and has assumed a centrally important mediatory function for innate immunity. In this study, we have further revealed the different expression pattern of chicken MIF in response to MDV infection and discussed in detail the potential role of this factor in the course of MDV infection.
MIF has emerged as a pivotal mediator of innate immunity (4). This protein modulates not only macrophage but also T cell functions (4), and especially exerts significant effects on regulation of anti-tumour and antigen-specific cytotoxic T-lymphocyte responses. The downregulation of the MIF gene in avian cells reflects the host immune response to virus infection or TLR stimulations. In fact, MIF expression was also decreased during early MDV infection, as MIF showed reduction in CEF at 24 hpi or 48 hpi and in chicken tissues at 7 dpi or 14 dpi. In addition, we also observed a continuous and gradual reduction of MIF expression in the avian HD11 macrophage cell line after a cell response was elicited by TLR stimulation, indicating that MIF in immune cells can be affected by TLR status. Studies
Increased expression of MIF in the spleen at 21 and 28 dpi and in CEF at 96 hpi could be relevant to MDV RB1B strain infection and replication, while in skin at 21 and 28 dpi it might be associated with the production of MDV virus particles. Firstly, we observed that the expression trend of MIF was gradually rising along with the replication of MDV after 48 hpi for RB1B or 24 hpi for CVI988 and was significantly up regulated at 72 and/or 96 hpi. The results suggested that MIF expression was influenced by MDV during the different stages of pathogenesis. However, MIF was not induced by the other two of the three avian viruses (ALV-J and REV) which induced immunosuppressive and tumourigenic diseases in poultry in infected CEF cells. This may indicate a direct role for MIF in MDV replication or pathogenesis. Induction of MIF expression was also found in herpes simplex virus type 1 (HSV-1) (18), human cytomegalovirus (HCMV), (6) and dengue virus (5). HCMV paralyses macrophage motility through release of MIF (6), and MIF promotes HIV-1 replication through the activation of HIV-1 long terminal repeats (LTR) (22).
However, the reduction of MIF in skin, spleen, and thymus during early and latent infection may promote MDV spread. This is because strong macrophage migration activity when MIF is reduced will not only enhance random migration of macrophages but elicit T lymphocyte activation, and this could offer an opportunity for macrophages that carry MDV to spread the virus to T lymphocytes, and then latently infected lymphocytes can disseminate the virus to different sites. Indeed, infection of macrophages
In the chicken spleen and skin infected with the very virulent and oncogenic strain RB1B, we observed the increased expression of MIF gene at 21 and 28 dpi. However, MIF expression was reduced in the non-oncogenic vaccine strain CVI988-infected spleen and in skin its expression did not show any significant change at the same time points. These findings suggested that MIF might be employed by MDV to induce lymphoma occurrence. Firstly, MIF sustains macrophage survival and function by suppressing p53-dependent apoptosis (17) and this is important for MDV-infected macrophage to spread the virus. Secondly, MIF exerts significant pro-tumour effects by regulation of anti-tumour T-lymphocyte responses. Host T-lymphocyte immunity is the biggest obstacle for MDV infection and the virus is not sufficient by itself for induction of T-cell lymphomas. MIF plays a dual role in both inhibiting T-cell responses and promoting tumour cell growth, and thus this regulatory mechanism could be employed by MDV to promote lymphoma occurrence. More importantly, MIF has been shown to mediate several important biological mechanisms and processes by which tumours thrive and spread. One of these mechanisms is the negative regulation of the important p53 tumour suppressor pathway (11), and the other is the modulation of hypoxic adaptation within the tumour microenvironment through the direct promotion of hypoxia-induced stabilisation of HIF-1α (20). However, the contributions of MIF to MDV-specific T-cell immunity and the mechanism of MD lymphoma occurrence need further investigation.
In summary, the present results provide the different expression pattern of MIF gene in response to the very virulent RB1B strain and CVI988 vaccine strain infections and might reveal a potential role of MIF in the pathogenesis of MDV infection. MIF might be a mechanism employed by MDV to increase virus replication and transport and promote MD lymphoma occurrence and evolution.