Uneingeschränkter Zugang

Cloning and differential expression analyses of Cdc42 from sheep

Yong-Jie Yang

Yong-Jie Yang

  • Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
  • Department of Food Science, College of Agriculture, Yanbian UniversityYanji, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Yang, Yong-Jie
, 
Zeng-Shan Liu

Zeng-Shan Liu

Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Liu, Zeng-Shan
, 
Shi-Ying Lu

Shi-Ying Lu

Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Lu, Shi-Ying
, 
Pan Hu

Pan Hu

Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Hu, Pan
, 
Chuang Li

Chuang Li

Department of Food Science, College of Agriculture, Yanbian UniversityYanji, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Li, Chuang
, 
Waqas Ahmad

Waqas Ahmad

  • Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
  • Section of Epidemiology and Public Health, College of Veterinary and Animal SciencesJhang, Pakistan
Suche nach diesem Autor auf
Sciendo|Google Scholar
Ahmad, Waqas
, 
Yan-Song Li

Yan-Song Li

Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Li, Yan-Song
, 
Yun-Ming Xu

Yun-Ming Xu

  • Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
  • Jiangsu Polytechnic College of Agriculture and ForestryJurong, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Xu, Yun-Ming
, 
Feng Tang

Feng Tang

  • Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
  • College of Animal Husbandry and Veterinary Medicine, Liaoning Medical UniversityJinzhou, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Tang, Feng
, 
Yu Zhou

Yu Zhou

Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Zhou, Yu
 und 
Hong-Lin Ren

Hong-Lin Ren

Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, Jilin UniversityChangchun, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Ren, Hong-Lin
  
30. März 2018
Cloning and differential expression analyses of Cdc42 from sheep's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Online veröffentlicht: 30. März 2018
Seitenbereich: 113 - 119
Eingereicht: 07. Sept. 2017
Akzeptiert: 14. Feb. 2018
DOI: https://doi.org/10.2478/jvetres-2018-0016
Schlüsselwörter
© 2018 Y.-J. Yang1et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Sequence analyses of OaCdc42. A. The full-length cDNA and deduced amino acid sequences of OaCdc42. GenBank accession number for OaCdc42 cDNA was KC425615. The conserved domain (CD) was in the frame. Double asterisks (∗∗) represent stop codon (TGA). Primers for 3′-, 5′-RACE are marked with underlined arrows. “S” in bold and italics indicates the predicted phosphorylated sites. Residue numbers of secondary structure are coloured per domain as in panel. B. The three-dimensional structure of OaCdc42. Each of α- helices and β-sheet is indicated by a different colour
Sequence analyses of OaCdc42. A. The full-length cDNA and deduced amino acid sequences of OaCdc42. GenBank accession number for OaCdc42 cDNA was KC425615. The conserved domain (CD) was in the frame. Double asterisks (∗∗) represent stop codon (TGA). Primers for 3′-, 5′-RACE are marked with underlined arrows. “S” in bold and italics indicates the predicted phosphorylated sites. Residue numbers of secondary structure are coloured per domain as in panel. B. The three-dimensional structure of OaCdc42. Each of α- helices and β-sheet is indicated by a different colour

Fig. 2

Multiple alignments of Cdc42 between sheep and other species. The amino acid sequence of OaCdc42 is underlined. (∗) – 100% identical; (:) – highly conserved; (.) – semi-conserved
Multiple alignments of Cdc42 between sheep and other species. The amino acid sequence of OaCdc42 is underlined. (∗) – 100% identical; (:) – highly conserved; (.) – semi-conserved

Fig. 3

Phylogenetic analysis of Cdc42 from sheep compared with other species. The phylogenetic tree was constructed by MAGA5.1 software using neighbour-joining (NJ) method. The numbers on the nodes reveal percentage frequencies in 1,000 bootstrap replications. The scale bar indicates 0.005 substitutions per site
Phylogenetic analysis of Cdc42 from sheep compared with other species. The phylogenetic tree was constructed by MAGA5.1 software using neighbour-joining (NJ) method. The numbers on the nodes reveal percentage frequencies in 1,000 bootstrap replications. The scale bar indicates 0.005 substitutions per site

Fig. 4

Tissue distribution of OaCdc42 mRNA from healthy sheep. The relative value of OaCdc42 mRNA was calculated using 2-ΔΔCt method and β-actin as the reference gene. Data were presented as mean ±SD (n = 3, ∗ P < 0.05; ∗∗ P < 0.01 vs. buffy coat). Error bars showed the SD. All tests were performed in triplicate
Tissue distribution of OaCdc42 mRNA from healthy sheep. The relative value of OaCdc42 mRNA was calculated using 2-ΔΔCt method and β-actin as the reference gene. Data were presented as mean ±SD (n = 3, ∗ P < 0.05; ∗∗ P < 0.01 vs. buffy coat). Error bars showed the SD. All tests were performed in triplicate

Fig. 5

The differential expression of OaCdc42 mRNA between Bm-infected sheep and S2-vaccinated sheep. Relative value of OaCdc42 mRNA was calculated using 2-ΔΔCt method and β-actin as the reference gene. Data were presented as mean ±SD (n = 9, ∗P < 0.05; ∗∗P < 0.01). Error bars showed the SD. All tests were performed in triplicate
The differential expression of OaCdc42 mRNA between Bm-infected sheep and S2-vaccinated sheep. Relative value of OaCdc42 mRNA was calculated using 2-ΔΔCt method and β-actin as the reference gene. Data were presented as mean ±SD (n = 9, ∗P < 0.05; ∗∗P < 0.01). Error bars showed the SD. All tests were performed in triplicate

Primers used for PCR amplification

Primer Nucleotide sequence (5’-3’) Method
Cdc42 F1 GTGTGAGACAAGGCCCGTAGGTATG 3’- RACE; outer
Cdc42 F2 TGGCCCCTTCCCCTCTCAATACTAG 3’-RACE; inner
Cdc42 R1 GCCATACCTACGGGCCTTGTCTCAC 5’-RACE; outer
Cdc42 R2 AGGTGCAGGGCATTTGTCATTATTG 5’-RACE; inner
Cdc42 F’ GTTGTTGTGGGTGATGGTGCTGTTG Real-time PCR
Cdc42 R’ CACTGAGAGGCAGACCAGAAACACG Real-time PCR
β-actin F’ CCCAAGGCCAACCGTGAGAAGATGA Real-time PCR
β-actin R’ CGAAGTCCAGGGCCACGTAGCAGAG Real-time PCR
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Molekularbiologie, Mikrobiologie und Virologie, Biologie, andere, Medizin, Veterinärmedizin
Zeitschrift RSS Feed