Brucellosis caused by
Cdc42 is a small GTPase, a member of the Rho subfamily, which can act as a molecular switch to control signal transduction pathways by cycling between an inactive state (GDP-bound) and an active state (GTP-bound) (10). In GTP-binding form, Cdc42 interacts with its downstream effectors to induce diverse cellular biological actions, including lamellipodia, filopodia and stress fibre formation (20), cell polarity (4), actin polymerisation (17), transport and endocytosis (19). As a key regulator of cellular actin dynamics, Cdc42 plays an important role in host defence (10, 20). Pathogen invasion is an actin-dependent process; Cdc42 can trigger extensive rearrangements of actin cytoskeleton to prevent bacteria or viruses from invading host cells (10, 16, 17). Many viruses, such as human immunodeficiency virus type 1 (HIV-1), respiratory syncytial virus (RSV), and Ebola virus (EBOV), have evolved to hijack Cdc42 to invade host cells (17).
In this study, we cloned Cdc42 from sheep (OaCdc42) by rapid amplification of cDNA ends (RACE), and then analysed tissue distribution and differential expression levels of OaCdc42 mRNA by RT-qPCR between infected sheep challenged with
A total of nine male sheep (
Heparinised peripheral blood and tissue samples (heart, liver, spleen, lung, kidneys, rumen, small intestine, skeletal muscles) from healthy sheep were collected according to Yang
According to fractional cDNA of OaCdc42 from the SSH cDNA library (22), its full-length cDNA was amplified by RACE using the SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer’s instructions. The primers for the RACE were listed in the Table 1.
Primers used for PCR amplification
Primer
Nucleotide sequence (5’-3’)
Method
Cdc42 F1
GTGTGAGACAAGGCCCGTAGGTATG
3’- RACE; outer
Cdc42 F2
TGGCCCCTTCCCCTCTCAATACTAG
3’-RACE; inner
Cdc42 R1
GCCATACCTACGGGCCTTGTCTCAC
5’-RACE; outer
Cdc42 R2
AGGTGCAGGGCATTTGTCATTATTG
5’-RACE; inner
Cdc42 F’
GTTGTTGTGGGTGATGGTGCTGTTG
Real-time PCR
Cdc42 R’
CACTGAGAGGCAGACCAGAAACACG
Real-time PCR
β-actin F’
CCCAAGGCCAACCGTGAGAAGATGA
Real-time PCR
β-actin R’
CGAAGTCCAGGGCCACGTAGCAGAG
Real-time PCR
The full-length of OaCdc42 cDNA and its predicted protein sequences were analysed using DNAStar5.0 software (DNASTAR, USA). The BLASTx algorithm was used to search for the homology of nucleotide and protein sequences of OaCdc42 (
RT-qPCR was used to investigate tissue distribution and differential expression of OaCdc42 mRNA. Two pairs of primers used for qPCR were also listed in Table 1. OaCdc42 cDNA was amplified to obtain 233 bp.
SPSS software version 13.0 (SPSS, USA) was used to analyse data and Student’s
The full-length of OaCdc42 cDNA was the first identified and registered in GenBank with the accession number KC425615. Its full-length was 1,609 bp containing 130 bp of 5′-untranslated region (UTR), 576 bp of ORF, and 903 bp of 3′-UTR. The ORF encoded a putative protein of 191 amino acid residuals with a deduced molecular weight (MW) of 21.22 kDa and theoretical isoelectric point (pI) of 6.38. OaCdc42 was predicted to contain a conserved domain from Thr3 to Leu177 (Fig. 1A), including GTP/Mg2+ binding site, GTPase-activating protein (GAP) interaction site, guanine nucleotide exchange factor (GEF) interaction site, Par6 cell polarity protein interaction site, Cdc42/Rac-interactive binding (CRIB) effector interaction site, ACK tyrosine kinase interaction site, guanine nucleotide dissociation inhibitor (GDI) interaction site, Switch I and II region, and G1, 2, 3, 4, and 5 boxes. Three serine phosphorylated sites were predicted to locate in Ser71, Ser89, and Ser124 (Fig. 1A). OaCdc42 was predicted to be a spherical protein composed of six α - helixes and six β - strands (Fig. 1B). In addition, there was no transmembrane domain and signal peptide to OaCdc42, which indicated that OaCdc42 might not be a secreted or membrane protein.
Sequence analyses of OaCdc42. Fig. 1
Multiple alignments revealed that the deduced amino acid sequence of OaCdc42 protein showed a high homology with other known Cdc42, and the highest identity of 99% was with
Multiple alignments of Cdc42 between sheep and other species. The amino acid sequence of OaCdc42 is underlined. (∗) – 100% identical; (:) – highly conserved; (.) – semi-conservedFig. 2
Phylogenetic analysis of Cdc42 from sheep compared with other species. The phylogenetic tree was constructed by MAGA5.1 software using neighbour-joining (NJ) method. The numbers on the nodes reveal percentage frequencies in 1,000 bootstrap replications. The scale bar indicates 0.005 substitutions per siteFig. 3
RT-qPCR was performed to investigate tissue distribution of OaCdc42 mRNA in healthy tissues;
Tissue distribution of OaCdc42 mRNA from healthy sheep. The relative value of OaCdc42 mRNA was calculated using 2-ΔΔCt method and Fig. 4
RT-qPCR was also carried out to investigate differential expression of OaCdc42 mRNA between infected and vaccinated sheep. The results showed that the expression of OaCdc42 mRNA differed significantly (P < 0.01) in infected sheep or vaccinated sheep in comparison to control animals after 40 and 30 days post-inoculation, respectively. Although the level of OaCdc42 mRNA from infected sheep showed up-regulation before 30 days post-challenge, there was no significant difference compared to the control (P > 0.05). Until 40 days post-challenge, it appeared significantly down-regulated (P < 0.01) and up-regulated (P < 0.01) sharply on day 60 post-challenge. OaCdc42 mRNA from vaccinated sheep was significantly down-regulated on days 30 (P < 0.01) and 40 (P < 0.01) post-inoculation, and up-regulated on day 60 (P < 0.01) post-inoculation. However, OaCdc42 mRNA between infected group and vaccinated group was significantly different (P < 0.05 or P < 0.01) on days 14, 30, and 60 post-inoculation and not significantly different (P > 0.05) on day 40 post-inoculation. Moreover, the level of OaCdc42 mRNA from both infected and vaccinated group showed irregularity (Fig. 5).
The differential expression of OaCdc42 mRNA between Bm-infected sheep and S2-vaccinated sheep. Relative value of OaCdc42 mRNA was calculated using 2-ΔΔCt method and Fig. 5
In this study, the full-length of OaCdc42 cDNA was reported and characterised for the first time. OaCdc42 cDNA was predicted to contain a conserved domain from Thr3 to Leu177, including GAP, GEF, and GDI interaction sites (Fig. 1A). GEF, GAP, and GDI were the three major regulatory proteins for regulating the cycle between the inactive GDP-bound form and active GTP-bound form, which is a typical characteristic for Rho GTPases (15). GEFs promote the exchange of GDP for GTP to activate the GTPase, whereas GAPs and GDI both negatively regulate the cycle to inactivate the GTPases. Therefore, OaCdc42 possibly has the capacity to act as a molecular switch to control signal transduction pathways by cycling between the GDP-bound form and the GTP-bound form.
The expression profile of OaCdc42 mRNA in healthy tissues was assessed. OaCdc42 mRNA was ubiquitously expressed in all tissue samples tested, although at a different level (Fig. 4). The broad expression profile of Cdc42 had been reported in buffalo (7) and swine (11). Differential expression of OaCdc42 in different tissues indicated that it may be involved in different physiological processes, such as cell growth (12), cell motility (8), apoptosis (2). The highest levels of OaCdc42 expressed in the intestine indicated that OaCdc42 must play an important role in the intestine, which needs further study.
In our study, OaCdc42 mRNA from infected or vaccinated sheep was significantly down-regulated on day 40 post-inoculation, and then significantly up-regulated 60 days post-inoculation (Fig. 5). Although OaCdc42 mRNA expression in infected sheep showed up-regulation before day 30 post-inoculation, there was no significant difference compared to the control (P > 0.05). The results implied that OaCdc42 may be weakly activated by virulent Bm, but not by avirulent S2. This is fully in line with the “stealthy” characteristics of
Previous studies indicated that Cdc42 could be activated by
At present, serological testing is still the primary clinical tool to diagnose brucellosis. However, lipopolysaccharide of vaccine strain of
In summary, the full-length of OaCdc42 cDNA was reported and characterised for the first time. OaCdc42 mRNA was widely expressed in all tested tissues, and the highest expression was detected in the intestine. The expression of OaCdc42 mRNA between vaccinated and infected sheep was significantly different (P < 0.05 or P < 0.01) on days: 14, 30, and 60 post-inoculation, but no difference (P > 0.05) was noted on day 40 post-inoculation. Moreover, the level of OaCdc42 mRNA from infected or vaccinated sheep showed irregularity. As our study has demonstrated, OaCdc42 is not a good potential diagnostic biomarker to distinguish