Tuberculosis (TB) is a major public health problem. One-third of the global population is infected with
Bacillus Calmette–Guérin (BCG) is a live strain of
BCG TRCS vaccine (lot No. FB03012), obtained from QSMI, was used for whole genomic sequencing. A working seed lot (BCG TRCS strain), which is used for production of BCG vaccine in Thailand, was characterized genetically.
Genomic DNA from BCG-TRCS vaccine (lot No. FB03012) was extracted using a genomic extraction kit (QIAamp DNA Mini Kit, Qiagen). Construction of the library and sequencing were performed by the Biochemistry Department, Medicine Faculty, Chulalongkorn University, Thailand. The library was prepared using a NEBNext Ultra DNA Library Prep Kit for Illumina. Whole genome sequencing and assembly were analyzed using a HiSeq 2000 Illumina system (New England Biolabs).
Genomic DNA from the working seed BCG (lot No. FB03012) was extracted using a genomic extraction kit (QIAamp DNA Mini Kit, Qiagen). PCR were performed with 2 primers RD16-F (5’-GGC TGG TGTT TCG TCA CTT C-3’), RD16-R (5’-ACA TTG GGA AAT CGC TGT TG-3’) [8]. PCR products were cloned using a pTG19-T vector (Vivantis, Malaysia) and then nucleotide sequences were determined by the 1st Base DNA sequencing service (Seri Kembangan, Malaysia).
The complete genomic DNA of the BCG TRCS strain was submitted to GenBank and compared with the reference genomic DNA using the basic BLAST alignment tool (National Center for Biotechnology Information (NCBI) website at
The working seed BCG TRCS strain was used as subject for conventional PCR amplification of the RD16 region with the primer set RD16-F and RD16- R. The PCR products showed 2 bands with different sizes (
Electrophoresis of PCR products of the RD16 region in a 12.5% polyacrylamide gel. Lane 1: BCG TRCS strain working seed lot. BCG TRCS had 2 types of band, the upper is type II (with the 22-bp deletion) and the lower is type I (BCG TRCS is composed of type I and II subpopulations). Lane 2: TB H37Rv was used as a positive control. The far-left lane shows a marker ladder (VC 100bp DNA Ladder, Vivantis) in units of bp.Figure 1
Sequencing and alignment of the RD16 region in 2 different types of BCG were determined using CLC Genomics Workbench 9 (CLC bio software, Qiagen) and showed a 22 bp difference (
Sequencing and alignment of the RD16 region in the 2 different types of BCG using CLC Genomics Workbench 9 (CLC bio software, Qiagen).Figure 2
The results from sequencing and alignment of the RD16 region in 3 BCG strains are shown in
RD16 region alignment of BCG Tokyo172 (type I), TB H37Rv, and BCG TRCS (type I) using CLC Genomics Workbench 9 (CLC bio software, Qiagen).Figure 3
The genome of the BCG TRCS strain is 4,371,707 bp. The genomic sequences of the BCG TRCS strain and BCG Tokyo 172 strain were found to be homologous. The results from identification of 4,076 genes indicated 3,963 CDS; 3 genes for rRNA, 45 genes for tRNA, and 62 pseudogenes; genome sequence details were deposited in GenBank (accession no. CP014566). Comparison of whole genome sequence between the BCG TRCS strain (CP014566) and BCG Tokyo 172 (AP010918) by next-generation sequencing analysis found 23 different points in amino acids (
Different points of amino acids between the BCG TRCS strain (CP014566) and BCG Tokyo 172 (AP010918) found by next-generation sequencing.No. Gene Gene position Difference of amino acid position No. Gene Gene position Difference of amino acid position No. Gene Gene position Difference of amino acid position 1 PE_PGRS3a 331866– 567 10 PE_PGRS20.2 1193553– 1,4,11–14,18, 17 PE_PGRS 2761378– 49–51,53, 334616 1194758 20–22,25,30,33, 43a 2762805 57–59,61, 36,39–41,43–17, 79,82,85– 49–50,52,56,59, 87,90,92– 65,68–71,74–75, 93,97 80,83–84,86,90, 94–96 2 PE_PGRS4 337829– 253 11 16S rRNA 1471256– Nonprotein coding 18 Lhr 3621834– 796 340333 1472792 3626375 3 JTY_0628 707570– 185 12 PE_PGRS30 1840495– 455–156,458– 19 sdliB 3693240– 88 708175 1843551 459,463,465, 3694031 467–168,473 4 PE_PGRS10 840318– 255 13 wag22b 1973263– 500 20 JTY 3396 3700080– Protein 842999 258 1975674 3700778 pattern changes 5 JTY_0977 1066242– 4–5 14 PE_PGRS41 2650648– 218 21 PE_PGRS 3908313– 515,520, 1067099 2651730 54 3914465 537,561, 564,570 6 PE_PGRS16 1092510– 441–442,457, 15 rpfE 2709525– Protein pattern 22 PE_PGRS 3923290– 654,656– 1094003 482,485–486, 2710121 changes 57 3925359 659,661– 491–497 683 7 PEPGRS16 1093960– Protein pattern 16 PE_PGRS43b 2757960– Protein pattern 23 JTY_3753 4105089– 178,214 1095282 changes 2761286 changes 4106411 8 PE_PGRS19 1190568– 256,265,268, 1192583 277,302 9 PE_PGRS20.1 1192916– 197,201,203– 1193530 205
The DNA alignment of the 16S rRNA gene showed several different points between BCG TRCS and BCG Tokyo 172 strains (
16S rRNA sequence alignment analysis of the BCG TRCS strain (CP014566) and BCG Tokyo 172 (AP010918) using CLC Genomics Workbench 9 (CLC bio software, Qiagen).Figure 4
Single nucleotide polymorphisms uniquely represent the BCG Tokyo species and those of the BCG TRCS strain remain the same as for the Japanese species (
Comparison of single nucleotide polymorphisms between BCG TRCS strain (CP014566) and BCG Tokyo 172 (AP010918).Gene Position BCG 172 Tokyio Thai Japanese GenBank: CP014566 GenBank: AP010918 253,186 A A JTY_0567 644,562 T T 765,342 C C Intergenic 2,717,585 C C JTY_3278 3,606,131 G G JTY_3735 4,087,391 G G
Analysis of Figure 5
Variable-number tandem repeat (VNTR) sequences are valuable markers for genotyping bacterial species. In the present study, 7 regions of difference (RDs) at the VNTR locus, which have shown polymorphism in the
Seven regions of difference (RDs) in the variable-number tandem repeat (VNTR) locus of the BCG TRCS strain.RD in VNTR locus Sequence from 5’→3’ Number of repeats 0557/intergenic ( GTCGAGCCCGACGACGATGCAGAGCGCGCAGCGCGATGAGAAGGAGTTGGGCGGTTAG (58 bp) 3 0580/intergenic ( TGCGCCGACGACGATGCAGAGCGTAGCGATGAGGTGGGGGCACCACCCGCTTGCGGGGGAGAGTGGCGCTGATGACC (77 bp) 3 3155/intergenic ( CGACCCGCGGCGCCCGGTCCCCGCGCTTGCGATCGCCACTGGCCCTGATGGTGG (54 bp) 4 3336/intergenic(Rv2980- TGCGCCGGGCGCGGCGGGTCGGCACCATCGGGCTAAGTGCCGATCGCAAGCGCGGCGCT (177 bp = 59 bpx3) 6 3820/intergenic ( CGATGCGGGCCGCGTAGCGGCCCGAGGAGGAGCCGGGCAATCCAGCCTGAGCCCGGTGA (59 bp) 3 4052 ( CCATCAGCCCCGTGGCGATCGCAAACCCCGCGCCTGGCGACAATGCGGCCCGCAAAACGGGCCGAGGAGGAGCCAGGCAATCACCCCAGAGCCGGGTGCAGCGGGTCGCCA (111 bp) 4 4155( TCGCGAGCCCGGCGCAGCCGGGCGAAGCGGGTCGGCACGCATCGGACCCCGTGACGA (57 bp) 11
BCG vaccine was originally developed from one strain of
The results of the RD16 region genotypes of the BCG TRCS strain from a working seed lot have shown a difference in the 2 PCR band product sizes, type I amplified 180 bp and type II 202 bp. PCR could identify type I with a 22-bp deletion and type II with the compete sequence in
Next-generation sequencing has indicated that the genome of BCG TRCS strain was 4,371,707 bp. DNA homology with BCG Tokyo 172 (AP010918) was 4,371,711 bp. Only 4 bp of DNA sequence and 23 4,371,711 bp. Only 4 bp of DNA sequence and 23 points of whole genome sequence were different between these BCG strains. VNTR sequences have emerged as valuable markers for the genotyping of several bacterial species, especially for genetically homogenous pathogens such as
The difference between BCG TRCS strain (CP014566) and BCG Tokyo 172 (AP010918) might result from genetic change in PE-polymorphic GC- rich-repetitive sequence (PGRS) family protein, hypothetical protein, putative oxidoreductase, 16S rRNA, putative resuscitation promoting factor, putative ATP-dependent helicase, and sdhB (
The result of 16S rRNA DNA alignment indicated some differences (
The BCG Tokyo 172 preparation is mainly composed of the type I genotype, with known characteristics of this preparation, such as high viability and good heat stability [21]. The type I subpopulation shows a growth advantage over the type II subpopulation both on culture media and in mice. Although type II was still present in every preparation including the seed lot, the proportion of type II subpopulation decreases during passaging [22]. Type I produces PGL, but type II cannot because of the
The BCG vaccine of BCG TRCS containing 2 types (I and II) from working seed lots found the proportion of type I to be more than type II in the PCR step. As the result of whole genome sequencing type I was found as the main population. Overall genetics of the BCG TRCS remain the same as BCG Tokyo 172 including the 7 RDs in