PCR-based Screening Approach: A Rapid Method to Detect the Biosynthetic Potential of Antimicrobials in Actinobacterial Strains

NAILA NOUREEN; MOHSIN TASSAWAR CHEEMA; SUMAIRA ANWAR; SHAHIDA HASNAIN; IMRAN SAJID

Open Access

PCR-based Screening Approach: A Rapid Method to Detect the Biosynthetic Potential of Antimicrobials in Actinobacterial Strains

NAILA NOUREEN

MOHSIN TASSAWAR CHEEMA

SUMAIRA ANWAR

SHAHIDA HASNAIN

and

IMRAN SAJID

| May 12, 2020

Polish Journal of Microbiology

Volume 69 (2020): Issue 2 (June 2020)

About this article

Cite

Published Online: May 12, 2020

Page range: 139 - 149

Received: Nov 29, 2019

Accepted: Mar 29, 2020

DOI: https://doi.org/10.33073/pjm-2020-016

Keywords
gene-based screening, polyene specific cytochrome P450 hydroxylase (CYP),

© 2020 Naila Noureen et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Neighbor-joining tree based on 16S rRNA gene sequences of closely related type strains. Evolutionary distance was calculated using Kimura 2-parameters with 1000 bootstrap value.

Antifungal activity of the selected polyene producing Streptomyces sp. against different fungal strains tested (Fusarium oxysporum (FO), Rhizoctonia solani (RS), and Aspergillus sp. (FN2). (A), (B), (C) Anti fungal activity of NR-1, NR-10, and NR-15 by the agar plug method against Fusarium oxysporum (FO), Rhizoctonia solani (RS). (D), (E), (F) Activity of NR-1, NR-14, and NR-15 by the agar plug method against Aspergillus sp. (FN2). (G), (H), (I) Activity of NR-1, NR-14, NR-10, H26, and CHX (cycloheximide) by the well diffusion method against Aspergillus sp.

Fig. 3.

Chemical profile of the selected Actinomycetes strains. (A) TLC plate at 366 nm. (B) TLC plate after spraying with Ehrlich’s reagent. (C) TLC plate after spraying with anisaldehyde reagent.

HPLC analysis of crude extracts of the polyene producing Streptomyces sp. (A) HPLC chromatogram of strain NR-1, (B) HPLC chromatogram of strain NR-10, (C) HPLC chromatogram of strain NR-14, (D) HPLC chromatogram of strain NR-15.

The relative abundance of the nrps, pks-1, cyps, oxy b genes in the selected Streptomyces strains.

Antifungal activity of the selected polyene producing Streptomyces sp. against different fungal strains (Fusarium oxysporum, Rhizoctonia solani, and Aspergillus sp.).

The fungus strain tested	Zone of inhibition in mm
The fungus strain tested	NR-1	NR-10	NR-14	NR-15	MM7	CHX
Fusarium oxysporum	17.0 ± 0.11	17.8 ± 0.18	14.7 ± 0.22	16.0 ± 0.25	5.1 ± 0.121	9.9 ± 0.26
Rhizoctonia solani	18.0 ± 0.32	12.2 ± 0.41	13.8 ± 0.45	16.6 ± 0.45	0.2 ± 0.11	10.9 ± 0.53
Aspergillus sp.	22.1 ± 0.40	19.0 ± 0.12	18.8 ± 0.27	18.3 ± 0.38	1.7 ± 0.42	14.0 ± 0.18

PCR primers for the nrps, pks-1, cyps, and oxy b genes.

Genes	Primers	Sequence (5’-3’)	Length	Tm	Product size	References
cyps	CYP-F	TGGATCGGCGACGACCGSVYCGT	23 bp	63.8	350 bp	Ayuso-Sacido and Genilloud 2005
cyps	CYP-R	CCGWASAGSAYSCCGTCGTACTT	23 bp	56.6	350 bp	Ayuso-Sacido and Genilloud 2005
oxy b	GLY-F	CTGGTCGGCAACCTGATGGAC	21 bp	61.7	560 bp	Ayuso-Sacido and Genilloud 2005
oxy b	GLY-R	CAGGTACCGGATCAGCTCGTC	21 bp	61.7	560 bp	Ayuso-Sacido and Genilloud 2005
pks1	K1F	TSAAGTCSAACATCGGBCA	19 bp	48.4	1200–1500 bp	Ayuso-Sacido and Genilloud 2005
pks1	M6R	CGCAGGTTSCSGTACCAGTA	20 bp	55.4	1200–1500 bp	Ayuso-Sacido and Genilloud 2005
nrps	A3F	GCSTACSYSATSTACACSTCSGG	23 bp	53.1	700 bp	Wood et al 2007
nrps	A7R	SASGTCVCCSGTSCGGTAS	19 bp	50.6	700 bp	Wood et al 2007

Streptomyces sp. GenBank accession numbers of 16S rRNA genes.

S. No. Given Code of Strain	GenBank Accession No.	Identified as
NR-1	MK243371	Streptomyces sp.
NR-10	MK243372	Streptomyces sp.
NR14	MK243373	Streptomyces sp.
NR15	MK243374	Streptomyces sp.
NR11	MN912434	Streptomyces sp.
C2	MN912435	Streptomyces pseudovenezuelae
D6-3	MN912436	Streptomyces flavogriseus
H34A	MN912437	Streptomyces sp.
H34B	MN912438	Streptomyces sp.
NR28	MN912439	Streptomyces flavoviridis
NR1	MN912440	Streptomyces sp.
NR5	MN912441	Streptomyces werraensis
10M	MN912442	Streptomyces sp.
C3	MN912443	Streptomyces fenghuangensis
H32B	MN912444	Streptomyces sp.
B5K	MN912445	Streptomyces fimbriatus
H31A	MN912446	Nocardioides sp.
M19	MN912447	Streptomyces albogriseolus
MM5	MN912448	Streptomyces Streptomyces griseus
NR3	MN912449	Streptomyces sp.
M63	MN912450	Streptomyces misionensis
M32	MN912451	Streptomyces sp.
M12	MN912452	Streptomyces steffisburgensis.
MM7	MN912453	Streptomyces fimbriatus.
M13	MN912454	Streptomyces niveoruber
D3-1	MN912455	Streptomyces bambusae
M29	MN912456	Streptomyces sp.
M28	MN912457	Streptomyces coerulescens
NR24	MN912458	Streptomyces silaceus
NR22	MN912459	Streptomyces sp.
H26	MN912460	Streptomyces steffisburgensis
M43	MN912461	Streptomyces rubrolavendulae
NR12	MN912462	Streptomyces neopeptinius
NR6	MN912463	Streptomyces coeruleoprunus
D3-3	MN912464	Streptomyces sp.
D3-2	MN912465	Streptomyces sp.
M93	KM062032	Streptomyces laurentii
M71	KM062033	Streptomyces vitaminophilus
M54	KM062034	Streptomyces hypolithicus
M51	KM062035	Streptomyces chartreusis

Streptomyces sp. GenBank accession numbers of the genes sequences.

S. No.	Isolates	Nucleotide length	GenBank Accession No.	% age homology	Genes encoding for
1.	NR-1	350 bp	98	CYP	MF279145
2.	NR-10	350 bp	100	CYP	MF279146
3.	NR14	350 bp	98	CYP	MK272790
4.	NR15	350 bp	98	CYP	MK272791
5.	NR-16	700 bp	100	NRPS	MF279147
6.	M13	700 bp	99	NRPS	MF279148
7.	NR-12	700 bp	98	NRPS	MF279150
8.	NR-6	1500 bp	98	PKS-1	MF279149

The translated DNA sequence of NR-1 based on six reading frames and their percentage similarity with cytochrome P450 hydroxylase (CYP) protein.

Sequence translation (EMBOSS Transq)	% similarity with cytochrome P450 hydroxylase protein
EMBOSS_001_1	98
EMBOSS_001_2	50
EMBOSS_001_3	No significant similarity found
EMBOSS_001_4	45
EMBOSS_001_5	No significant similarity found
EMBOSS_001_6	No significant similarity found

eISSN:: 2544-4646
Language:: English

Publication timeframe:: 4 times per year
Journal Subjects:: Life Sciences, Microbiology and Virology

Journal RSS Feed

PCR-based Screening Approach: A Rapid Method to Detect the Biosynthetic Potential of Antimicrobials in Actinobacterial Strains

Article Category: original-paper

Published Online: May 12, 2020

Page range: 139 - 149

Received: Nov 29, 2019

Accepted: Mar 29, 2020

DOI: https://doi.org/10.33073/pjm-2020-016

Keywords
gene-based screening, polyene specific cytochrome P450 hydroxylase (CYP),

© 2020 Naila Noureen et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

Fig. 3.

Fig 4.

Fig. 5.

Antifungal activity of the selected polyene producing Streptomyces sp. against different fungal strains (Fusarium oxysporum, Rhizoctonia solani, and Aspergillus sp.).

PCR primers for the nrps, pks-1, cyps, and oxy b genes.

Streptomyces sp. GenBank accession numbers of 16S rRNA genes.

Streptomyces sp. GenBank accession numbers of the genes sequences.

The translated DNA sequence of NR-1 based on six reading frames and their percentage similarity with cytochrome P450 hydroxylase (CYP) protein.

PCR-based Screening Approach: A Rapid Method to Detect the Biosynthetic Potential of Antimicrobials in Actinobacterial Strains

Article Category: original-paper

Published Online: May 12, 2020

Page range: 139 - 149

Received: Nov 29, 2019

Accepted: Mar 29, 2020

DOI: https://doi.org/10.33073/pjm-2020-016

Keywordsgene-based screening, polyene specific cytochrome P450 hydroxylase (CYP),

© 2020 Naila Noureen et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

Fig. 3.

Fig 4.

Fig. 5.

Antifungal activity of the selected polyene producing Streptomyces sp. against different fungal strains (Fusarium oxysporum, Rhizoctonia solani, and Aspergillus sp.).

PCR primers for the nrps, pks-1, cyps, and oxy b genes.

Streptomyces sp. GenBank accession numbers of 16S rRNA genes.

Streptomyces sp. GenBank accession numbers of the genes sequences.

The translated DNA sequence of NR-1 based on six reading frames and their percentage similarity with cytochrome P450 hydroxylase (CYP) protein.

Keywords
gene-based screening, polyene specific cytochrome P450 hydroxylase (CYP),