Isolation and Identification of Chlamydia abortus from Aborted Ewes in Sulaimani Province, Northern Iraq
Article Category: original-paper
Published Online: Feb 28, 2020
Page range: 65 - 71
Received: Dec 11, 2019
Accepted: Jan 30, 2020
DOI: https://doi.org/10.33073/pjm-2020-009
Keywords
© 2020 Eman Dhahir Arif et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Ovine chlamydiosis is also called ovine enzootic abortion (OEA) or enzootic abortion of ewes (EAE). It is one of the most significant causal agents of reproductive failure in small ruminants, which is induced by
Chlamydiosis causes abortion in sheep and goats in the final 2–3 weeks of pregnancy with the appearance of a stillborn and grossly inflamed placenta (Nietfeld 2001, Walder et al. 2003). Also,
Abortion in the late stages of gestation by
Etiologic diagnosis of ovine chlamydiosis depends on bacteriological testing on embryonated chicken eggs and chlamydial DNA amplification by polymerase chain reaction (PCR) (Sachse et al. 2009, Szymanska-Czerwinska et al. 2013).
Infections of
We collected 30 samples of aborted fetuses from five herds of nonvaccinated sheep in different regions around Sulaimani province. Fifteen samples were from Kalar, ten from Said Sadiq, and five from Chamchamal (Fig. 1). The samples composed of tissue collected by using disposable blades and scissors from recently aborted fetuses (liver, spleen, and lung) and their dams (placental caruncle and cotyledon) that had abortions in the previous 2–4 days. Collected samples were put in plastic containers, labeled, and transferred in a cooled box to the Research Center at the College of Veterinary Medicine/University of Sulaimani for isolation and identification of
Fig. 1.
Map of Iraq with Sulaimani province, showing the districts, Kalar, SaidSadiq, and Chamchamal, where samplings were carried out.

For isolation of
After six days of incubation, the vitality of the egg to be inoculated was checked with a candling lamp. Candling (holding an intense light below the egg to observe the embryo in a darkened room) was used to determine and mark the location of the embryo and egg’s air sac. The shell was cleaned with 70% ethanol, and the air sac was marked with a pencil, followed by drilling a small hole into the shell over the top of the air sac. After injecting about 0.2 ml of the inoculums (10% suspension of tissue), the hole was sealed with nail varnish (Soomro et al. 2012). The eggs were incubated at 37°C and candled daily. Eggs that showed embryonic death during 4–10 days after inoculation were kept while the eggs in which the embryo died within 24 hours after inoculation were discarded. Eggs containing dead embryos were kept overnight at 4°C, and the yolk sac membranes were harvested using aseptic techniques in a biosafety cabinet after the rinsing the eggshells with alcohol. The yolk sac was washed two times with pH 7.2 phosphate-buffered saline and cut into small pieces. The pieces were then ground with a pestle and mortar to prepare a cell suspension, as described earlier (Li et al. 2015). The presence of
The targeted genes and PCR primers used for the detection of
Target gene | Primer name | Primer sequence (5′–3′) | Amplified fragment length (bp) | Reference |
---|---|---|---|---|
|
omp-F | ATGAAAAAACTCTTGAAATCGG | 1058 | Arshi et al. 2011 |
omp-R | CAAGATTTTCTAGACTTCATTTTGTT | |||
|
B4-F | TGGCTCGGTTGCCAATATCAA | 223 | Baily et al. 1992 |
B5-R | CGCGCTTGCCTTTCAGGTCTG |
The total DNA was subjected to simplex PCR amplification using PCR PreMix (GeNet Bio, South Korea). The reaction was executed in 0.2 ml PCR tubes. The constituents of the PCR tube were 10 μl master mix, 4 μl DNA, and 1 μl (10 pmol) of each of the forward and reverse primers. The final volume of 20 μl was accomplished by adding 4 μl diethylpyrocarbonate (DEPC)-treated water.
The thermal cycler program was started with denaturation at 95°C for five minutes. After that, 40 cycles of denaturation (95°C for 30 seconds), annealing at 58°C for 30 seconds for
The PCR products were examined by loading 7 μl on 1% agarose gel in 1 × Tris/Borate/EDTA (TBE) buffer. The gel was stained with 5 μl Safe dye, and electrophoresis was done using 120 volts for 50 minutes. The Safe-Blue Illuminator/Electrophoresis System was used to visualize the bands of amplicons, which were analyzed based on the pattern of migration by comparing them to a 100 bp DNA ladder.
Phylogenic trees were produced using the
Detection of
Name of district | Number of samples collected | Number positive for |
Number positive for |
---|---|---|---|
Kalar | 15 | 1 (6.66) | 14 (93.33) |
Said Sadiq | 10 | 0 | 10 (100) |
Chamchamal | 5 | 0 | 5(100) |
Total | 30 | 1 (3.33) | 29 (96.66) |
Fig. 2.
Embryonated egg showing a dead chick embryo five days after inoculation. The infected yolk sacs were thin-walled, and their blood vessels were severely congested. Yolk appeared as a right-colored liquid, and the growth of the embryo was stunted.

Fig. 3.
Phylogenic trees based on the

Abortions by infectious agents in ewes and goats cause considerable economic loss. In addition to
In the current study, primers of the
Embryonated egg inoculation is considered the gold standard for the isolation of chlamydia. However, the necessity of long-time incubation is its only disadvantage (Condon and Oakey 2007). The findings in this study showed that only one smear from all the impression smear of yolk sac membranes of chicken eggs was found positive for
The result of this study showed that 29 out of 30 (96.66%) samples were infected with
Molecular analysis reveals that