1. bookVolume 69 (2020): Issue 1 (March 2020)
Journal Details
First Published
04 Mar 1952
Publication timeframe
4 times per year
access type Open Access

Isolation and Identification of Chlamydia abortus from Aborted Ewes in Sulaimani Province, Northern Iraq

Published Online: 28 Feb 2020
Volume & Issue: Volume 69 (2020) - Issue 1 (March 2020)
Page range: 65 - 71
Received: 11 Dec 2019
Accepted: 30 Jan 2020
Journal Details
First Published
04 Mar 1952
Publication timeframe
4 times per year

Abortion in small ruminants is a significant problem in Iraq and causes severe economic losses in sheep farms. Chlamydia abortus causes enzootic abortion in ewes and is associated with reproductive problems in sheep in Sulaimani province – Northern Iraq. During a lambing season in 2017, abortion was widespread among several sheep flocks in different regions of Sulaimani (Kalar, Said Sadiq, and Chamchamal), and C. abortus was one of the causes. Accordingly, we carried out this study to isolate and identify C. abortus in aborted ewes in these regions. We collected 30 samples of aborted fetuses from five herds in which abortions had been observed. The pathogen isolation was done by inoculation into embryonated chicken eggs and conventional PCR was used to identify C. abortus in clinical specimens. C. abortus was identified in one of the 30 aborted fetuses (3.33%) from the Kalar district, and all the remaining 29 samples (96.66%) were found positive to Brucella abortus. The gene ompA encoding the outer membrane protein of C. abortus was sequenced and got the accession number MK643153 in NCBI GenBank. The sequence was named C. abortus strain Sul/2017. Our isolate showed 99.79% homology with Sul/014 (accession No. KY399850) and differed from the latter by two amino acid substitutions at E115K and K259N. The topology of the phylogenetic tree based on the ompA gene showed that the isolate belongs to C. abortus and has a common ancestor with isolates of sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243, respectively.



Chlamydia abortus (family: Chlamydiaceae) is a non-motile, coccoid, pleomorphic, Gram-negative bacterium. It is an obligate intracellular parasite that causes different diseases in humans and animals (Everett et al. 1999, Madico et al. 2000, Silva et al. 2006).

Ovine chlamydiosis is also called ovine enzootic abortion (OEA) or enzootic abortion of ewes (EAE). It is one of the most significant causal agents of reproductive failure in small ruminants, which is induced by C. abortus (DeGraves et al. 2004, Spičic et al. 2015). The pathogen efficiently colonizes the placental trophoblasts (Borel et al. 2006, Campos-Hernández et al. 2014).

Chlamydiosis causes abortion in sheep and goats in the final 2–3 weeks of pregnancy with the appearance of a stillborn and grossly inflamed placenta (Nietfeld 2001, Walder et al. 2003). Also, C. abortus constitutes a hazard to pregnant women, as many cases have been reported, which were caused by Chlamydia (Pospischil et al. 2002, Walder et al. 2005).

Abortion in the late stages of gestation by Chlamydia results in severe losses in many sheep-raising areas globally, especially where herds are intensely crowded during the parturient period (Halbert 2008, Rodolakis and Mohamad 2010). The disease can lead to the delivery of full-term stillborn lambs. Some of the delivered lambs fail to survive longer than two days. It is also common for an infected ewe to deliver one dead lamb and one or more weak or healthy lambs during multiple births. Infection usually spreads into a new flock by the introduction of infected animals. The disease usually causes a small number of abortions in the first year. In the next year, the rate may increase to infect around 30% of the ewes (Longbottom and Coulter 2003).

Etiologic diagnosis of ovine chlamydiosis depends on bacteriological testing on embryonated chicken eggs and chlamydial DNA amplification by polymerase chain reaction (PCR) (Sachse et al. 2009, Szymanska-Czerwinska et al. 2013).

Infections of C. abortus in sheep have generally been documented serologically in Sulaimani province, in the north of Iraq. However, studies on pathogen isolation and detection by PCR are rare in this region. Therefore, we conducted this study to isolate C. abortus in sheep in Sulaimani province, Iraq using egg-inoculation and PCR molecular techniques. We also conducted a phylogenic analysis to compare our isolate with other Chlamydia species that were deposited in GenBank using the ompA gene as a comparison.

Materials and Methods

Study area and sample collection. During the birth season of 2017, March to May, abortion in sheep flocks was reported by veterinarians in several regions of Sulaimani province in the northeast of Iraq. The farms had a history of abortion in the previous seasons. The management system of sheep herds in these districts is classical; the animal herds belong to different owners. The sheep are fed indoor on grain, hay, and silage and are left to graze on pasture. Different animal species may graze together on the same pasture or share rams for fertility between herds. Farmers in these areas rear local breed or Arabic (Awasi) sheep.

We collected 30 samples of aborted fetuses from five herds of nonvaccinated sheep in different regions around Sulaimani province. Fifteen samples were from Kalar, ten from Said Sadiq, and five from Chamchamal (Fig. 1). The samples composed of tissue collected by using disposable blades and scissors from recently aborted fetuses (liver, spleen, and lung) and their dams (placental caruncle and cotyledon) that had abortions in the previous 2–4 days. Collected samples were put in plastic containers, labeled, and transferred in a cooled box to the Research Center at the College of Veterinary Medicine/University of Sulaimani for isolation and identification of C. abortus.

Fig. 1.

Map of Iraq with Sulaimani province, showing the districts, Kalar, SaidSadiq, and Chamchamal, where samplings were carried out.

Isolation of C. abortus . Tissue samples from cotyledons, placentas, and fetal organs were collected and processed for egg inoculation. Homogenization of the tissues was accomplished by grinding using a sterile pestle and mortar. The homogenized tissues were suspended in the sucrose-phosphate-glutamate (SPG) medium containing sucrose (0.22 mM), K2HPO4 (7.1 mM), L-glutamic acid (4.9 mM), fetal bovine serum (10%), streptomycin (100 μg/ml), gentamicin (50 μg/ml), and nystatin (50 μg/ml) to make a 10% suspension. The suspension was centrifuged at 2000 rpm for 5–10 minutes. After that, the supernatants were collected and aliquoted in small volumes. Part of the supernatant was used directly for the isolation of C. abortus in embryonated eggs, and McCoy cell or the extraction of DNA, and the remainder was stored at –70°C.

For isolation of C. abortus in the yolk sac membranes of chicken eggs, specific-pathogen-free, 6 to 8-day-old embryonated hen’s eggs were inoculated with the tissue suspension of the aborted animals.

After six days of incubation, the vitality of the egg to be inoculated was checked with a candling lamp. Candling (holding an intense light below the egg to observe the embryo in a darkened room) was used to determine and mark the location of the embryo and egg’s air sac. The shell was cleaned with 70% ethanol, and the air sac was marked with a pencil, followed by drilling a small hole into the shell over the top of the air sac. After injecting about 0.2 ml of the inoculums (10% suspension of tissue), the hole was sealed with nail varnish (Soomro et al. 2012). The eggs were incubated at 37°C and candled daily. Eggs that showed embryonic death during 4–10 days after inoculation were kept while the eggs in which the embryo died within 24 hours after inoculation were discarded. Eggs containing dead embryos were kept overnight at 4°C, and the yolk sac membranes were harvested using aseptic techniques in a biosafety cabinet after the rinsing the eggshells with alcohol. The yolk sac was washed two times with pH 7.2 phosphate-buffered saline and cut into small pieces. The pieces were then ground with a pestle and mortar to prepare a cell suspension, as described earlier (Li et al. 2015). The presence of C. abortus was confirmed by staining impression smears with Giemsa. The smears were prepared from highly vascularized areas of the yolk sac membranes of chicken eggs. The smears were then fixed by absolute methanol and stained with Giemsa solution. The stained slides were examined with a light microscope using 1000× magnification for the presence of purple inclusion bodies (Dagnall and Wilsmore 1990).

DNA extraction. The samples were subjected to DNA extraction using a DNA extraction kit (GeNet Bio, South Korea). The procedure was conducted following instructions provided by the manufacturer.

Oligonucleotides and PCR amplification. We used a set of genus-specific primers for discrimination of C. abortus and Brucella abortus from common infectious agents that cause abortion in sheep. The omp-F and omp-R primers were designed from the ompA gene sequence of C. abortus, which encode an amplicon size was 1058 bp and were previously used by Arshi et al. (2011), while B4-F and B5-R primers were designed from the bcsp31 gene sequence of B. abortus. Primers encode an amplicon of 223 bp (Baily et al. 1992). The name, sequence, target gene, the predicted amplified fragment, as well as the melting temperature, are listed in Table I The primers were developed by Macrogen® (South Korea) for our study.

The targeted genes and PCR primers used for the detection of Chlamydia abortus and Brucella abortus in aborted ewes.

Target gene Primer name Primer sequence (5′–3′) Amplified fragment length (bp) Reference
ompA omp-F ATGAAAAAACTCTTGAAATCGG 1058 Arshi et al. 2011
bcsp31 B4-F TGGCTCGGTTGCCAATATCAA 223 Baily et al. 1992

The total DNA was subjected to simplex PCR amplification using PCR PreMix (GeNet Bio, South Korea). The reaction was executed in 0.2 ml PCR tubes. The constituents of the PCR tube were 10 μl master mix, 4 μl DNA, and 1 μl (10 pmol) of each of the forward and reverse primers. The final volume of 20 μl was accomplished by adding 4 μl diethylpyrocarbonate (DEPC)-treated water.

The thermal cycler program was started with denaturation at 95°C for five minutes. After that, 40 cycles of denaturation (95°C for 30 seconds), annealing at 58°C for 30 seconds for C. abortus and 57°C for B. abortus, and extension (72°C for 45 seconds) were run with the final extension at 72°C for five minutes.

The PCR products were examined by loading 7 μl on 1% agarose gel in 1 × Tris/Borate/EDTA (TBE) buffer. The gel was stained with 5 μl Safe dye, and electrophoresis was done using 120 volts for 50 minutes. The Safe-Blue Illuminator/Electrophoresis System was used to visualize the bands of amplicons, which were analyzed based on the pattern of migration by comparing them to a 100 bp DNA ladder.

Sequencing of the ompA gene and phylogenic analysis. The PCR products of the C. abortus ompA gene were sequenced in the Macrogen Sequencing Facility in South Korea. Sequencing was performed several times to verify the identity of each nucleotide, and the gene sequences were presented to GenBank and got the accession number MK643153.

Phylogenic trees were produced using the ompA genes of 75 strains of Chlamydia species (Fig. 3). The sequences were obtained from GenBank and MLST (http://pubmlst.org/chlamydiales/) websites for Chlamydiales. Multiple alignments were done with the Clustal W method (Thompson et al. 1994), and MEGA 7 was implemented to execute a phylogenetic analysis with Neighbor-Joining. The bootstrap measures were determined from 1000 repeats of the original data.


Samples. In the current study, 30 samples were taken from aborted fetuses from different herds of sheep from three districts in Sulaimani. One sample (3.33%) from aborted ewes was found positive for C. abortus both by yolk sac inoculation and PCR (Table II). All the remaining 29 samples were positive to B. abortus (96.66%).

Detection of Chlamydia abortus and Brucella abortus in different herds of sheep from three districts in Sulaimani province by PCR.

Name of district Number of samples collected Number positive for C. abortus (%) Number positive for B. abortus (%)
Kalar 15 1 (6.66) 14 (93.33)
Said Sadiq 10 0 10 (100)
Chamchamal 5 0 5(100)
Total 30 1 (3.33) 29 (96.66)

Inoculation of embryonated eggs. Examination of embryonated eggs revealed the death of chick embryo 4–5 days after inoculation, and the infected yolk sacs were thin-walled, and their blood vessels were severely congested (Fig. 2). Yolk appeared as a bright-colored liquid, and the growth of the embryo was stunted. Embryos were suffering from curled toes, and their bodies were covered with hemorrhage. Only one impression smear of the yolk sac membrane of an egg was found positive for C. abortus. Giemsa stain revealed chlamydial elementary bodies as small stained purple cocci occurring individually and in clusters in the cytoplasm of infected cells.

Fig. 2.

Embryonated egg showing a dead chick embryo five days after inoculation. The infected yolk sacs were thin-walled, and their blood vessels were severely congested. Yolk appeared as a right-colored liquid, and the growth of the embryo was stunted.

Identification of C. abortus . In the present study, C. abortus was positive for the ompA gene, based on agarose gel electrophoresis, which demonstrated the expected amplicon of about 1058 bp. The results were affirmed by determining the sequence of the PCR product, and the sequence received the accession number MK643153 in NCBI GenBank and was named C. abortus strain Sul/2017.

Sequence analysis. The sequence of the partial ompA gene of C. abortus strain Sul/2017 showed 99.89% homology with two isolates from the UK with the accession numbers LN554882 and LN554883. However, the isolate in our study showed 99.79% homology with a previous isolate from Sulaimani (Sul/014, accession No. KY399850). Sequence alignment of Sul/2017 with 100 isolates of C. abortus showed that the Iraqi strain had one exclusive single nucleotide polymorphism (SNP, A59050) that caused amino acid substitution A92G in the ompA gene. However, Sul/2017 differed from Sul/2014 by two amino acid substitutions at E115K and K259N.

Phylogenic analysis. The phylogenetic tree topology, based on the ompA gene, showed that Chlamydia Sul/2017 from Iraq belonged to C. abortus (Fig. 3). The phylogenetic tree revealed that Sul/2017 has a common ancestor with isolates from sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243, respectively. The partial omp1 gene of Sul/2017 has been compared with 75 sequences of Chlamydia genus that were published in GenBank and MLST websites for Chlamydiales (http://pubmlst.org/chlamydiales/). According to the phylogenetic tree, the isolates were distinctly divided into seven clusters; each cluster represented specific species of Chlamydia (Fig. 3). The cluster of C. abortus was subdivided into three groups. The topology of the phylogenetic tree showed that the field isolate Sul/2017 had a common ancestor with Sul/2014, CAAB7, 1H, and Krauss-15 isolates in group 2 of C. abortus.

Fig. 3.

Phylogenic trees based on the ompA gene showed that the Sul/2017 chlamydia from Iraq belonged to C. abortus and revealed that Sul/2017 has a common ancestor, respectively. The partial ompA gene of Sul/2017 has been compared with 75 sequences of Chlamydia species that were published in GenBank and MLST websites for Chlamydiales (http://pubmlst.org/chlamydiales/). The tree shows that Sul/2017 has a common ancestor with isolates of sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243 and with Sul/2014, CAAB7, H and Krauss-15 isolates that were in a group 2 of Chlamydia abortus.


Abortions by infectious agents in ewes and goats cause considerable economic loss. In addition to Brucella species, Campylobacter fetus subspecies fetus, C. abortus, Salmonella, and Listeria monocytogenes are responsible for abortion in small ruminants (Türütoğlu et al. 2000). In previous surveys, the less-sensitive and -specific complement fixation test had been used, which was described by the World Organization for Animal Health (OIE) as the most commonly used method for serodiagnosis of animals chlamydiosis. However, the technique is tedious, has limited sensitivity, and frequently afflicted by cross-reactions between chlamydial species (McCauley et al. 2007). The recently evolved serodiagnostic tests are primarily based on two main cross-reactive antigens present in all chlamydial species, lipopolysaccharide and the major outer membrane protein (MOMP). Thus, these tests are not species-specific for diagnosing animals infected by OEA. Possibilities for diagnostic detection of chlamydia are better after the introduction of DNA-based methods, particularly the PCR, which permit direct identification from clinical samples and differentiation of species (Longbottom et al. 2001).

In the current study, primers of the C. abortus ompA gene were used; only one sample (3.33%) from aborted ewes was found positive for C. abortus both by yolk sac inoculation and PCR. This result represents the first insight into the presence of C. abortus infection of sheep in Sulaimani province, Iraq, using molecular methods.

Embryonated egg inoculation is considered the gold standard for the isolation of chlamydia. However, the necessity of long-time incubation is its only disadvantage (Condon and Oakey 2007). The findings in this study showed that only one smear from all the impression smear of yolk sac membranes of chicken eggs was found positive for C. abortus by Giemsa stain. Bacterial isolation in embryonated eggs depends on the viable C. abortus elementary bodies in the infected material, which are small and dense. This result was following a study done by Kalender et al. (2013). In this study, the cytological examination of the inoculated egg revealed the typical vascular congestion of yolk sac membranes. The variations in the results of our study and other studies may be attributed to many factors. For example, the geographical location, size and type of samples taken, animal breed, grazing and management strategies, nutritional deficiency, and uncontrolled restriction of diseased animal movement from infected areas are factors that may affect the incidence rate of C. abortus.

The result of this study showed that 29 out of 30 (96.66%) samples were infected with B. abortus using the genus-specific (B4/B5) primers. This result is higher than the outcome of Mohammed et al. (2013), nine out of 15 (60%), and lower than the result of Mukherjee et al. (2007), 19 out of 19 (100%), who detected the Brucella genus using the same primers. This variation may be due to the sampling time from aborted animals (Dağ et al. 2012).

Molecular analysis reveals that C. abortus Sul/2107 strain was the causative agent of abortion in the sheep herd. There was not enough genetic information about C. abortus in Iraq before this study in the GenBank database, except for one isolate (Sul/2014). Genetic analyses indicated that the strain in the present study differed from the previous strain in the region. The number of C. abortus isolates worldwide were 6,718 variable locations documented within the complete phylogeny (Seth-Smith et al. 2017). On the other hand, there were 17,163 variable locations recognized within the phylogeny of C. trachomatis (Harris et al. 2012), and 47,710 variable locations were identified within the strains of C. psittaci (Read et al. 2013). This variation was evident in our study, in which each species of Chlamydia was in a different cluster (Fig. 3). Because of low diversity in C. abortus (Seth-Smith et al. 2017), there were no apparent differences among the strains according to the geographical region or host range within the groups of C. abortus cluster. This outcome made Sul/2017 share a common ancestor with a wide range of strains that originated from different hosts and countries. The grouping within C. abortus was not clear due to a low rate of diversity in the species. Therefore, to make the phylogram more prominent, we used cutoff value with the condensed tree option in the phylogenic tree constriction. Further research is recommended for the whole genome analysis of all Chlamydia strains in Iraq and the neighboring countries due to insufficient genetic information about C. abortus in those countries.

Fig. 1.

Map of Iraq with Sulaimani province, showing the districts, Kalar, SaidSadiq, and Chamchamal, where samplings were carried out.
Map of Iraq with Sulaimani province, showing the districts, Kalar, SaidSadiq, and Chamchamal, where samplings were carried out.

Fig. 2.

Embryonated egg showing a dead chick embryo five days after inoculation. The infected yolk sacs were thin-walled, and their blood vessels were severely congested. Yolk appeared as a right-colored liquid, and the growth of the embryo was stunted.
Embryonated egg showing a dead chick embryo five days after inoculation. The infected yolk sacs were thin-walled, and their blood vessels were severely congested. Yolk appeared as a right-colored liquid, and the growth of the embryo was stunted.

Fig. 3.

Phylogenic trees based on the ompA gene showed that the Sul/2017 chlamydia from Iraq belonged to C. abortus and revealed that Sul/2017 has a common ancestor, respectively. The partial ompA gene of Sul/2017 has been compared with 75 sequences of Chlamydia species that were published in GenBank and MLST websites for Chlamydiales (http://pubmlst.org/chlamydiales/). The tree shows that Sul/2017 has a common ancestor with isolates of sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243 and with Sul/2014, CAAB7, H and Krauss-15 isolates that were in a group 2 of Chlamydia abortus.
Phylogenic trees based on the ompA gene showed that the Sul/2017 chlamydia from Iraq belonged to C. abortus and revealed that Sul/2017 has a common ancestor, respectively. The partial ompA gene of Sul/2017 has been compared with 75 sequences of Chlamydia species that were published in GenBank and MLST websites for Chlamydiales (http://pubmlst.org/chlamydiales/). The tree shows that Sul/2017 has a common ancestor with isolates of sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243 and with Sul/2014, CAAB7, H and Krauss-15 isolates that were in a group 2 of Chlamydia abortus.

Detection of Chlamydia abortus and Brucella abortus in different herds of sheep from three districts in Sulaimani province by PCR.

Name of district Number of samples collected Number positive for C. abortus (%) Number positive for B. abortus (%)
Kalar 15 1 (6.66) 14 (93.33)
Said Sadiq 10 0 10 (100)
Chamchamal 5 0 5(100)
Total 30 1 (3.33) 29 (96.66)

The targeted genes and PCR primers used for the detection of Chlamydia abortus and Brucella abortus in aborted ewes.

Target gene Primer name Primer sequence (5′–3′) Amplified fragment length (bp) Reference
ompA omp-F ATGAAAAAACTCTTGAAATCGG 1058 Arshi et al. 2011
bcsp31 B4-F TGGCTCGGTTGCCAATATCAA 223 Baily et al. 1992

Baily GG, Krahn JB, Drasar BS, Stoker NG. Detection of Brucella melitensis and Brucella abortus by DNA amplification. J Trop Med Hyg. 1992 Aug;95(4):271–275. Baily GG Krahn JB Drasar BS Stoker NG. Detection of Brucella melitensis and Brucella abortus by DNA amplification . J Trop Med Hyg. 1992 Aug ; 95 ( 4 ): 271 275 . Search in Google Scholar

Borel N, Thoma R, Spaeni P, Weilenmann R, Teankum K, Brugnera E, Zimmermann DR, Vaughan L, Pospischil A. Chlamydia-related abortions in cattle from Graubunden, Switzerland. Vet Pathol. 2006 Sep;43(5):702–708. https://doi.org/10.1354/vp.43-5-702 Borel N Thoma R Spaeni P Weilenmann R Teankum K Brugnera E Zimmermann DR Vaughan L Pospischil A. Chlamydia-related abortions in cattle from Graubunden, Switzerland . Vet Pathol. 2006 Sep ; 43 ( 5 ): 702 708 . https://doi.org/10.1354/vp.43-5-702 10.1354/vp.43-5-702 Search in Google Scholar

Campos-Hernández E, Vázquez-Chagoyán JC, Salem AZM, Saltijeral-Oaxaca JA, Escalante-Ochoa C, López-Heydeck SM, de Oca-Jiménez RM. Prevalence and molecular identification of Chlamydia abortus in commercial dairy goat farms in a hot region in Mexico. Trop Anim Health Prod. 2014 Aug;46(6):919–924. https://doi.org/10.1007/s11250-014-0585-6 Campos-Hernández E Vázquez-Chagoyán JC Salem AZM Saltijeral-Oaxaca JA Escalante-Ochoa C López-Heydeck SM de Oca-Jiménez RM. Prevalence and molecular identification of Chlamydia abortus in commercial dairy goat farms in a hot region in Mexico . Trop Anim Health Prod. 2014 Aug ; 46 ( 6 ): 919 924 . https://doi.org/10.1007/s11250-014-0585-6 10.1007/s11250-014-0585-6 Search in Google Scholar

Condon K, Oakey J. Detection of Chlamydiaceae DNA in veterinary specimens using a family-specific PCR. Lett Appl Microbiol. 2007 Aug;45(2):121–127. https://doi.org/10.1111/j.1472-765X.2007.02169.x Condon K Oakey J. Detection of Chlamydiaceae DNA in veterinary specimens using a family-specific PCR . Lett Appl Microbiol. 2007 Aug ; 45 ( 2 ): 121 127 . https://doi.org/10.1111/j.1472-765X.2007.02169.x 10.1111/j.1472-765X.2007.02169.x Search in Google Scholar

Dağ S, Büyük F, Özen H, Çelebi Ö, Karaman M, Akça D, Şahin M. Detection of Brucella spp. in vaginal swab samples of aborting cattle: comparison of immunoperoxidase to bacteriological culture technique. Kafkas Univ Vet Fak Derg. 2012;18(4):617–622. Dağ S Büyük F Özen H Çelebi Ö Karaman M Akça D Şahin M. Detection of Brucella spp. in vaginal swab samples of aborting cattle: comparison of immunoperoxidase to bacteriological culture technique . Kafkas Univ Vet Fak Derg. 2012 ; 18 ( 4 ): 617 622 . Search in Google Scholar

Dagnall GJR, Wilsmore AJ. A simple staining method for the identification of chlamydial elementary bodies in the fetal membranes of sheep affected by ovine enzootic abortion. Vet Microbiol. 1990 Jan;21(3):233–239. https://doi.org/10.1016/0378-1135(90)90034-S Dagnall GJR Wilsmore AJ. A simple staining method for the identification of chlamydial elementary bodies in the fetal membranes of sheep affected by ovine enzootic abortion . Vet Microbiol. 1990 Jan ; 21 ( 3 ): 233 239 . https://doi.org/10.1016/0378-1135(90)90034-S 10.1016/0378-1135(90)90034-S Search in Google Scholar

DeGraves FJ, Kim T, Jee J, Schlapp T, Hehnen HR, Kaltenboeck B. Reinfection with Chlamydophila abortus by uterine and indirect cohort routes reduces fertility in cattle preexposed to Chlamydophila. Infect Immun. 2004 May 01;72(5):2538–2545. https://doi.org/10.1128/IAI.72.5.2538-2545.2004 DeGraves FJ Kim T Jee J Schlapp T Hehnen HR Kaltenboeck B. Reinfection with Chlamydophila abortus by uterine and indirect cohort routes reduces fertility in cattle preexposed to Chlamydophila . Infect Immun. 2004 May 01 ; 72 ( 5 ): 2538 2545 . https://doi.org/10.1128/IAI.72.5.2538-2545.2004 10.1128/IAI.72.5.2538-2545.200438784115102761 Search in Google Scholar

Everett KDE, Bush RM, Andersen AA. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms. Int J Syst Bacteriol. 1999 Apr 01;49(2):415–440. https://doi.org/10.1099/00207713-49-2-415 Everett KDE Bush RM Andersen AA. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms . Int J Syst Bacteriol. 1999 Apr 01 ; 49 ( 2 ): 415 440 . https://doi.org/10.1099/00207713-49-2-415 10.1099/00207713-49-2-41510319462 Search in Google Scholar

Mohammed SI, Habeb KA, Faik AJ. Molecular Diagnosis of Brucella species in Baghdad. Baghdad Sci J. 2013 Mar 03;10(1):109–115. https://doi.org/10.21123/bsj.10.1.109-115 Mohammed SI Habeb KA Faik AJ. Molecular Diagnosis of Brucella species in Baghdad . Baghdad Sci J. 2013 Mar 03 ; 10 ( 1 ): 109 115 . https://doi.org/10.21123/bsj.10.1.109-115 10.21123/bsj.10.1.109-115 Search in Google Scholar

Halbert G. Diseases of sheep. Can Vet J. 2008;49(7):702. Halbert G. Diseases of sheep . Can Vet J. 2008 ; 49 ( 7 ): 702 . Search in Google Scholar

Harris SR, Clarke IN, Seth-Smith HMB, Solomon AW, Cutcliffe LT, Marsh P, Skilton RJ, Holland MJ, Mabey D, Peeling RW, et al. Whole-genome analysis of diverse Chlamydia trachomatis strains identifies phylogenetic relationships masked by current clinical typing. Nat Genet. 2012 Apr;44(4):413–419, S1. https://doi.org/10.1038/ng.2214 Harris SR Clarke IN Seth-Smith HMB Solomon AW Cutcliffe LT Marsh P Skilton RJ Holland MJ Mabey D Peeling RW , Whole-genome analysis of diverse Chlamydia trachomatis strains identifies phylogenetic relationships masked by current clinical typing . Nat Genet. 2012 Apr ; 44 ( 4 ): 413 419 , S1. https://doi.org/10.1038/ng.2214 10.1038/ng.2214337869022406642 Search in Google Scholar

Kalender H, Kiliç A, Eröksüz H, Muz A, Kilinç Ü, Taşdemir B. Identification of Chlamydophila abortus infection in aborting ewes and goats in Eastern Turkey. Rev Med Vet. 2013;164(6):295–301. Kalender H Kiliç A Eröksüz H Muz A Kilinç Ü Taşdemir B. Identification of Chlamydophila abortus infection in aborting ewes and goats in Eastern Turkey . Rev Med Vet. 2013 ; 164 ( 6 ): 295 301 . Search in Google Scholar

Li Z, Cao X, Fu B, Chao Y, Cai J, Zhou J. Identification and characterization of Chlamydia abortus isolates from yaks in Qinghai, China. Biomed Res Int. 2015;2015:658519. Li Z Cao X Fu B Chao Y Cai J Zhou J. Identification and characterization of Chlamydia abortus isolates from yaks in Qinghai, China . Biomed Res Int. 2015 ; 2015 : 658519 . Search in Google Scholar

Longbottom D, Coulter LJ. Animal chlamydioses and zoonotic implications. J Comp Pathol. 2003 May;128(4):217–244. https://doi.org/10.1053/jcpa.2002.0629 Longbottom D Coulter LJ. Animal chlamydioses and zoonotic implications . J Comp Pathol. 2003 May ; 128 ( 4 ): 217 244 . https://doi.org/10.1053/jcpa.2002.0629 10.1053/jcpa.2002.062912834606 Search in Google Scholar

Longbottom D, Psarrou E, Livingstone M, Vretou E. Diagnosis of ovine enzootic abortion using an indirect ELISA (rOMP91B iELISA) based on a recombinant protein fragment of the polymorphic outer membrane protein POMP91B of Chlamydophila abortus. FEMS Microbiol Lett. 2001 Feb;195(2):157–161. https://doi.org/10.1111/j.1574-6968.2001.tb10514.x Longbottom D Psarrou E Livingstone M Vretou E. Diagnosis of ovine enzootic abortion using an indirect ELISA (rOMP91B iELISA) based on a recombinant protein fragment of the polymorphic outer membrane protein POMP91B of Chlamydophila abortus . FEMS Microbiol Lett. 2001 Feb ; 195 ( 2 ): 157 161 . https://doi.org/10.1111/j.1574-6968.2001.tb10514.x 10.1111/j.1574-6968.2001.tb10514.x11179645 Search in Google Scholar

Madico G, Quinn TC, Boman J, Gaydos CA. Touchdown enzyme time release-PCR for detection and identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci using the 16S and 16S-23S spacer rRNA genes. J Clin Microbiol. 2000;38(3):1085–1093. https://doi.org/10.1128/JCM.38.3.1085-1093.2000 Madico G Quinn TC Boman J Gaydos CA. Touchdown enzyme time release-PCR for detection and identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci using the 16S and 16S-23S spacer rRNA genes . J Clin Microbiol. 2000 ; 38 ( 3 ): 1085 1093 . https://doi.org/10.1128/JCM.38.3.1085-1093.2000 10.1128/JCM.38.3.1085-1093.2000 Search in Google Scholar

McCauley LME, Lancaster MJ, Young P, Butler KL, Ainsworth CGV. Comparison of ELISA and CFT assays for Chlamydophila abortus antibodies in ovine sera. Aust Vet J. 2007 Aug;85(8):325–328. https://doi.org/10.1111/j.1751-0813.2007.00189.x McCauley LME Lancaster MJ Young P Butler KL Ainsworth CGV. Comparison of ELISA and CFT assays for Chlamydophila abortus antibodies in ovine sera . Aust Vet J. 2007 Aug ; 85 ( 8 ): 325 328 . https://doi.org/10.1111/j.1751-0813.2007.00189.x 10.1111/j.1751-0813.2007.00189.x Search in Google Scholar

Mukherjee F, Jain J, Patel V, Nair M. Multiple genus-specific markers in PCR assays improve the specificity and sensitivity of diagnosis of brucellosis in field animals. J Med Microbiol. 2007 Oct 01;56(10):1309–1316. https://doi.org/10.1099/jmm.0.47160-0 Mukherjee F Jain J Patel V Nair M. Multiple genus-specific markers in PCR assays improve the specificity and sensitivity of diagnosis of brucellosis in field animals . J Med Microbiol. 2007 Oct 01 ; 56 ( 10 ): 1309 1316 . https://doi.org/10.1099/jmm.0.47160-0 10.1099/jmm.0.47160-0 Search in Google Scholar

Nietfeld JC. Chlamydial infections in small ruminants. Vet Clin North Am Food Anim Pract. 2001 Jul;17(2):301–314, vi. https://doi.org/10.1016/S0749-0720(15)30030-X Nietfeld JC. Chlamydial infections in small ruminants . Vet Clin North Am Food Anim Pract. 2001 Jul ; 17 ( 2 ): 301 314 , vi. https://doi.org/10.1016/S0749-0720(15)30030-X 10.1016/S0749-0720(15)30030-X Search in Google Scholar

Pospischil A, Thoma R, Hilbe M, Grest P, Gebbers JO. Abortion in woman caused by caprine Chlamydophila abortus (Chlamydia psittaci serovar 1). Swiss Med Wkly. 2002 Feb 9;132(5–6):64–66. Pospischil A Thoma R Hilbe M Grest P Gebbers JO. Abortion in woman caused by caprine Chlamydophila abortus (Chlamydia psittaci serovar 1) . Swiss Med Wkly. 2002 Feb 9 ; 132 ( 5–6 ): 64 66 . 10.1024/0036-7281.144.9.46312677684 Search in Google Scholar

Read TD, Joseph SJ, Didelot X, Liang B, Patel L, Dean D. Comparative analysis of Chlamydia psittaci genomes reveals the recent emergence of a pathogenic lineage with a broad host range. MBio. 2013 May 01;4(2):e00604-12. https://doi.org/10.1128/mBio.00604-12 Read TD Joseph SJ Didelot X Liang B Patel L Dean D. Comparative analysis of Chlamydia psittaci genomes reveals the recent emergence of a pathogenic lineage with a broad host range . MBio. 2013 May 01 ; 4 ( 2 ): e00604 - 12 . https://doi.org/10.1128/mBio.00604-12 10.1128/mBio.00604-12362292223532978 Search in Google Scholar

Rodolakis A, Mohamad KY. Zoonotic potential of Chlamydophila. Vet Microbiol. 2010 Jan;140(3–4):382–391. https://doi.org/10.1016/j.vetmic.2009.03.014 Rodolakis A Mohamad KY. Zoonotic potential of Chlamydophila . Vet Microbiol. 2010 Jan ; 140 ( 3–4 ): 382 391 . https://doi.org/10.1016/j.vetmic.2009.03.014 10.1016/j.vetmic.2009.03.01419345022 Search in Google Scholar

Sachse K, Vretou E, Livingstone M, Borel N, Pospischil A, Longbottom D. Recent developments in the laboratory diagnosis of chlamydial infections. Vet Microbiol. 2009 Mar;135(1–2):2–21. https://doi.org/10.1016/j.vetmic.2008.09.040 Sachse K Vretou E Livingstone M Borel N Pospischil A Longbottom D. Recent developments in the laboratory diagnosis of chlamydial infections . Vet Microbiol. 2009 Mar ; 135 ( 1–2 ): 2 21 . https://doi.org/10.1016/j.vetmic.2008.09.040 10.1016/j.vetmic.2008.09.04018986778 Search in Google Scholar

Seth-Smith HMB, Busó LS, Livingstone M, Sait M, Harris SR, Aitchison KD, Vretou E, Siarkou VI, Laroucau K, Sachse K, et al. European Chlamydia abortus livestock isolate genomes reveal unusual stability and limited diversity, reflected in geographical signatures. BMC Genomics. 2017 Dec;18(1):344. https://doi.org/10.1186/s12864-017-3657-y Seth-Smith HMB Busó LS Livingstone M Sait M Harris SR Aitchison KD Vretou E Siarkou VI Laroucau K Sachse K , European Chlamydia abortus livestock isolate genomes reveal unusual stability and limited diversity, reflected in geographical signatures . BMC Genomics. 2017 Dec ; 18 ( 1 ): 344 . https://doi.org/10.1186/s12864-017-3657-y 10.1186/s12864-017-3657-y541595228472926 Search in Google Scholar

Silva FG, Freitas JC, Müller EE. Chlamydophila abortus in production animals. Cienc Rural. 2006;36(1):342–348. https://doi.org/10.1590/S0103-84782006000100057 Silva FG Freitas JC Müller EE. Chlamydophila abortus in production animals . Cienc Rural. 2006 ; 36 ( 1 ): 342 348 . https://doi.org/10.1590/S0103-84782006000100057 10.1590/S0103-84782006000100057 Search in Google Scholar

Soomro S, Murray R, Woldehiwet Z, Soomro N. Comparisons of polymerase chain reaction and isolation in cell culture and embryonated hen’s eggs for the detection of Chlamydophila abortus in aborted ovine/caprine placenta. J. Vet. Anim. Sci. 2012;2:32–39. Soomro S Murray R Woldehiwet Z Soomro N. Comparisons of polymerase chain reaction and isolation in cell culture and embryonated hen’s eggs for the detection of Chlamydophila abortus in aborted ovine/caprine placenta . J. Vet. Anim. Sci. 2012 ; 2 : 32 39 . Search in Google Scholar

Spičic S, Račić Ivana, Andrijanić M, Duvnjak S, Zdelar-Tuk M, Stepanić M, Cvetnić Z. Emerging cases of chlamydial abortion in sheep and goats in Croatia and Bosnia and Herzegovina. Berl Munch Tierarztl Wochenschr. 2015 May-Jun;128(5–6):183–187. Spičic S Račić Ivana Andrijanić M Duvnjak S Zdelar-Tuk M Stepanić M Cvetnić Z. Emerging cases of chlamydial abortion in sheep and goats in Croatia and Bosnia and Herzegovina . Berl Munch Tierarztl Wochenschr. 2015 May-Jun ; 128 ( 5–6 ): 183 187 . Search in Google Scholar

Szymanska-Czerwinska M, Niemczuk K, Galinska EM. Serological and nested PCR survey to determine the occurrence of chlamydia infections in the Polish cattle population. Ann Agric Environ Med. 2013;20(4):682–686. Szymanska-Czerwinska M Niemczuk K Galinska EM. Serological and nested PCR survey to determine the occurrence of chlamydia infections in the Polish cattle population . Ann Agric Environ Med. 2013 ; 20 ( 4 ): 682 686 . Search in Google Scholar

Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994 Nov 11;22(22): 4673–4680. https://doi.org/10.1093/nar/22.22.4673 Thompson JD Higgins DG Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice . Nucleic Acids Res. 1994 Nov 11 ; 22 ( 22 ): 4673 4680 . https://doi.org/10.1093/nar/22.22.4673 10.1093/nar/22.22.46733085177984417 Search in Google Scholar

Türütoğlu H, Iyisan A, Öztürk M, Gülyaz V. Abortions related to Chlamydia psittaci and Salmonella abortus ovis in a sheep farm. Pendik Vet Mikrobiyol Derg. 2000;31(2):5–17. Türütoğlu H Iyisan A Öztürk M Gülyaz V. Abortions related to Chlamydia psittaci and Salmonella abortus ovis in a sheep farm . Pendik Vet Mikrobiyol Derg. 2000 ; 31 ( 2 ): 5 17 . Search in Google Scholar

Walder G, Hotzel H, Brezinka C, Gritsch W, Tauber R, Würzner R, Ploner F. An unusual cause of sepsis during pregnancy: recognizing infection with Chlamydophila abortus. Obstet Gynecol. 2005 Nov;106(5, Part 2):1215–1217. https://doi.org/10.1097/01.AOG.0000161060.69470.9c Walder G Hotzel H Brezinka C Gritsch W Tauber R Würzner R Ploner F. An unusual cause of sepsis during pregnancy: recognizing infection with Chlamydophila abortus . Obstet Gynecol. 2005 Nov ; 106 ( 5, Part 2 ): 1215 1217 . https://doi.org/10.1097/01.AOG.0000161060.69470.9c 10.1097/01.AOG.0000161060.69470.9c16260577 Search in Google Scholar

Walder G, Meusburger H, Hotzel H, Oehme A, Neunteufel W, Dierich MP, Würzner R. Chlamydophila abortus pelvic inflammatory disease. Emerg Infect Dis. 2003 Dec;9(12):1642–1644. https://doi.org/10.3201/eid0912.020566 Walder G Meusburger H Hotzel H Oehme A Neunteufel W Dierich MP Würzner R. Chlamydophila abortus pelvic inflammatory disease . Emerg Infect Dis. 2003 Dec ; 9 ( 12 ): 1642 1644 . https://doi.org/10.3201/eid0912.020566 10.3201/eid0912.020566303433414720414 Search in Google Scholar

Recommended articles from Trend MD

Plan your remote conference with Sciendo