1. bookVolume 68 (2019): Issue 2 (June 2019)
Journal Details
First Published
04 Mar 1952
Publication timeframe
4 times per year
access type Open Access

Prevalence and Antimicrobial Properties of Lactic Acid Bacteria in Nigerian Women During the Menstrual Cycle

Published Online: 28 Jun 2019
Volume & Issue: Volume 68 (2019) - Issue 2 (June 2019)
Page range: 203 - 209
Received: 07 Dec 2018
Accepted: 01 Feb 2019
Journal Details
First Published
04 Mar 1952
Publication timeframe
4 times per year

The composition of vagina lactic acid bacteria (LAB) differs within the different ethnic group. This study is aimed at determining the prevalence of LAB with their antimicrobial properties in Nigerian women’s vagina during different stages of the menstrual cycle. Microorganisms were isolated from vaginal swabs of ten Nigerian women during different stages of the menstrual cycle and identified by partial sequencing of the 16S rRNA gene. The antimicrobial properties of the LAB were tested against the multidrug-resistant uropathogens. The prevalence of LAB was higher during ovulation period while during menstruation period, it declined. Twenty-five LAB isolates were identified as three species, namely: Lactobacillus plantarum (15), Lactobacillus fermentum (9), Lactobacillus brevis (1) and one acetic acid bacteria – Acetobacter pasteurianus. The LAB had antimicrobial activities against the three uropathogens with zones of inhibition from 8 to 22 mm. The presence of LAB inhibits the growth of Staphylococcus sp. GF01 also in the co-culture. High LAB counts were found during ovulation period with L. plantarum as a dominant species while during menstruation, there was a decrease in the LAB counts. The isolated LAB has antimicrobial properties against the urogenital pathogens tested thus exhibiting their potential protective role against uropathogens.



A healthy human vagina is primarily colonized by the genus Lactobacillus (Shiraishi et al. 2011) and it builds a barrier separating the pathogens from the epithelium, thereby, protecting the vagina. The pH ~ 4.5 also maintains the balance of the vaginal ecosystem as well as antimicrobial substances e.g. hydrogen peroxide against pathogens (Ayeni and Adeniyi 2013; Ghartey 2014). Occasional and recurrent vaginal yeast and bacterial imbalances are common among premenopausal women, which can be due to hormonal changes during menstrual cycle, antibiotic treatment, pregnancy, sexual intercourse, excessive intimate hygiene and use of tampons, which may predispose a woman to infections.

The hormonal changes occur during the reproductive stages with the resulting fluctuating levels of hormones that regulate the menstrual cycle. This is an important influence on the vaginal microbiota during human reproductive years (Farage et al. 2010). Women of different racial groups may exhibit different composition of microbial communities and, correspondingly, different susceptibility to vaginal infections. Women are more prone to urinary tract infections (UTI) than men due to the position of the urethra. The reduction in protective vaginal flora may increase the risk of these infections (Gupta et al. 2017).

Lactic acid bacteria (LAB) have been shown to inhibit the in vitro growth of pathogenic microorganisms, e.g. Klebsiella spp. Neisseria gonorrhoeae, Pseudomonas aeruginosa, Candida albicans, Staphylococcus aureus, Escherichia coli, etc. (Ayeni and Adeniyi 2012; Adeoshun and Ayeni 2016). This can be achieved mainly through the action of lactic acid (Graver and Wade 2011). During menstruation, the diminished population of lactobacilli and the presence of menstrual fluid make the vaginal less acidic, therefore, more prone to colonization by pathogenic microorganisms. Changes between different bacterial species in the vagina are associated with menses (Gajer et al. 2012).

The antimicrobial activity of the vaginal fluids correlates with an increased lactic acid content, low pH and competitive exclusion. The increased susceptibility to disease may be also related to vaginal microbiota fluctuations (Gajer et al. 2012). Ayeni and Adeniyi (2013) and Agboola et al. (2014) had reported the presence of organisms in healthy and menstruating women with their antimicrobial properties in Nigeria. However, there is no information to establish changes in vaginal microbiota at different stages of the menstrual cycle and the antimicrobial effects of the isolated LAB. Therefore, this study aimed at determining the prevalence of LAB at different stages of the menstrual cycle in Nigerian women with their potential antimicrobial properties.

Materials and Methods

Pathogens. Ten clinical strains of uropathogens: Klebsiella spp., Staphylococcus spp. and Pseudomonas spp. (isolated from urine) were collected from the culture collection of the Medical Microbiological Laboratory of the University College of Medicine (UCH), Ibadan.

Sample collections, isolation, and lactic acid bacteria viability counts. Ethical approval (UI/EC/13/0258) was obtained from the Institutional Ethical Committee (IEC), Institute for Advanced Medical Research and Training (IAMRAT), College of Medicine, University of Ibadan, Ibadan, Nigeria. Ten Nigerian women volunteers aged between 20–40 years were recruited into this study. They were premenopausal, self-declared healthy, not on antibiotics or hormonal therapy for at least four months, not on contraceptives, having regular menstrual cycle, i.e. a complete menstrual cycle between 25–30 days every month, and exhibiting the three different stages within the cycle. For each volunteer, Day 1 of menstrual flow is noted as day one of the menstrual cycle. For a five-days flow, samples were taken on day 3 and for a 4-days flow, samples were taken on day 2. Safe period is between 6th–12th day of the menstrual cycle while the ovulation period is between 13th–15th day of the menstrual cycle. The safe period samples were taken on day 6 after menstrual flow stopped. The ovulation period samples were obtained midway of the menstrual cycle. The signed informed consent was obtained from each volunteer. The samples were collected from the volunteers during different stages of their menstrual cycle between August and September 2014. The volunteers used sterile swab sticks to swab the vagina according to the standard protocols. The samples were collected during the three different stages of the menstrual cycle and immediately inoculated in 10 ml MRS broth, (Oxoid, UK) adjusted to pH 5, shaken vigorously for 10 s and incubated under the microaerophilic condition using CampyGen™ at 37°C for 24 h. Serial dilutions were done using sterile normal saline and the suspension of the suitable dilution factor was plated out on MRS agar by pour plate method, then incubated under microaerophilic condition at 37°C for 48 h. The initial colony counts were noted and colonies were picked according to the differences in their colony morphology on MRS agar plates and isolated by streaking onto another MRS agar to obtain a distinct colony. Gram staining and catalase test were carried out and only the colonies that were Gram-positive and catalase-negative were picked and stored in MRS broth containing 20% w/v glycerol at –20°C for further characterization and identification.

Identification of Lactic Acid Bacteria. The DNA of the LAB isolated were extracted by QuickExtract™ DNA extraction solution (Epicentre, Wisconsin) according to the manufacturer’s instructions. The PCR mixture consisted of a total volume of 20 µl (1 µl of DNA extract, 10 pmol of each primer, and 25 µl of 2-fold concentrated RedTaq Ready Mix (SigmaAldrich, Germany)). The primers used for amplification were (5’-TGTAA AACGGCCAGTAGAGTTTGATC(AC)TGGCTCAG) and (5’-CAGGAAACAGCTATGACCG(AT)ATTAC CGCGGC(GT)GCTG), containing an M13 primer sequence (Montanaro et al. 2016). PCR conditions were 95°C for 5 min; 35 cycles each of 95°C for 15 s, 58°C for 30 s, and 72°C for 45 s; and a final step at 72°C for 10 min. Ten microliters of the amplified products were analyzed on 1.5% agarose gels and subsequently sequenced using the BigDye Terminator v3.1 sequencing kit (Applied Biosystems, California). The sequence was blasted against the NCBI database for species identification. The nucleotide sequences for the 16S rRNA genes have been deposited in the GenBank database under accession numbers KX261342 to KX261366.

Antibiotic susceptibility of uropathogens. Ten uropathogenic strains were collected and screened against seven antibiotics by disk diffusion methods. A bacterial lawn was accomplished by spreading inoculum from 108 dilution factor of the pathogen culture which is approximately equivalent to 0.5 McFarland standards by a sterile swab stick. The antibiotic disks containing ceftazidime (30 µg), cefotaxime (30 µg), cefuroxime (30 µg), Augmentin (amoxicillin clavulanate) (10 µg), ciprofloxacin (30 µg), ofloxacin (30 µg), and gentamycin (30 µg) were placed on the surface of the solidified agar with the aid of sterile forceps and incubated aerobically at 37°C for 24 h. The susceptibility of the test organisms to the antibiotics used was documented by measuring the diameter of the clear zones of inhibition in millimeter (mm) around the antibiotics disks, and the results were interpreted according to the guidelines of European Committee on Antimicrobial Susceptibility Testing (2015). The resistant strains were selected for LAB antimicrobial study.

Determination of LAB antimicrobial activities against bacterial uropathogens. To study the antimicrobial potential of the LAB against clinical isolates of uropathogens, three different methods were employed, which are: using the cell free supernatant via agar well diffusion method, using the viable LAB cells via agar overlay method, and co-culture of the LAB and uropathogens.

Determination of the antimicrobial activity of the cell-free supernatant. The LAB isolates were grown in MRS broth overnight under the microaerophilic condition at 37°C, centrifuged at 10 000 rpm for 10 min and the supernatant decanted. The antimicrobial activities of the cell-free supernatant were determined twice, i.e. before and after neutralization to pH of 6.5 with 1 M NaOH, using the agar well diffusion assay against Staphylococcus sp. GF01, Pseudomonas aeruginosa GF01, and Klebsiella sp. GF01.

Determination of the antimicrobial activity of viable lactic acid bacterial cells. The modified agar overlaid method as described by Ayeni et al. (2011) was used in this study. In summary, the LAB cells in broth were inoculated in two 2-cm-long lines on an MRS agar surface and then incubated at 37°C for 24–48 h in microaerophilic conditions. The plates were overlaid with 0.2 ml of an overnight broth culture of the test pathogen vehiculated in 10 ml soft nutrient agar and incubated at 37°C under aerobic condition. The plates were then examined for a clear zone of inhibition around the line of the LAB and the clear zones were measured in millimeters.

Coculture of lactic acid bacteria and uropathogens. The interference of the LAB strains with the growth of uropathogenic strains was evaluated by coincubating Staphylococcus sp. GF01 with four representative strains of LAB (Lactobacillus brevis GF021, obtained from the menstruation period, Lactobacilus fermentum GF002, Lactobacillus plantarum GF011, obtained from the safe period and Lactobacillus fermentum GF019, obtained from the ovulation period). This was done in two series of experiments.

In the first experiment, an overnight culture of Staphylococcus sp. GF01 was inoculated into 5 ml double strength nutrient broth and then added to 5 ml of overnight culture of the LAB and the mixture was incubated for 24 h. The monoculture of the mixture, the LAB and Staphylococcus sp. GF01 (control) was evaluated at time zero (t0) and after incubation. For the second experiment, 5 ml of Staphylococcus sp. GF01 was incubated for 8 h, after which it was centrifuged and the supernatant discarded, 5 ml of double strength nutrient broth was added to resuspend the pellets, vortexed and added to a 5 ml of overnight culture of the LAB. Staphylococcus sp. GF01 monoculture and the mixture was plated out at 8 h and 24 h to evaluate the growth of Staphylococcus sp. GF01.


The three organisms used exhibited high resistance (i.e. 0 mm zones of inhibition) towards most of the antibiotics used. The Pseudomonas and Staphylococcus strains tested were resistant to ceftazidime, cefotaxime, cefuroxime, Augmentin (amoxicillin clavulanate) but sensitive to ciprofloxacin, ofloxacin, and gentamycin, while the Klebsiella sp. GF01 strain was completely resistant to all the antibiotics.

Ten volunteers were assessed for a level of LAB in their vagina at different stages of the menstrual cycle. It was observed that in seven (70%) out of the ten volunteers, there was a significant shift of the LAB level from low to high (8 × 105 to 7.6 × 109) CFU/ml over the course of the menstrual cycle. In the remaining three (30%) volunteers, the presence of LAB was not observed throughout the menstrual cycle (Table I).

Evaluation of the LAB counts at different stages of the menstrual cycle.

WeekMenstruation PeriodSafe PeriodOvulation Period
Total CFU/mlLAB CFU/mlTotal CFU/mlLAB CFU/mlTotal CFU/mlLAB CFU/ml
11.02 × 1084.2 × 1071.81 × 10109.3 × 1092.22 × 10101.51 × 1010
25.6 × 1071.0 × 1061.91 × 10105.2 × 1091.90 × 10101.14 × 1010
37.8 × 1071.2 × 1061.89 × 10107.4 × 1092.53 × 10101.51 × 1010
47.0 × 1072.2 × 1061.87 × 10101.89 × 10109.8 × 109
59.2 × 1071.4 × 1061.52 × 10104.2 × 1091.87 × 10101.02 × 1010
66.1 × 1078 × 1058.3 × 1093.0 × 1091.12 × 10107.6 × 109
71.13 × 1082.5 × 1062.11 × 10105.4 × 1093.26 × 10101.02 × 1010
82.0 × 103Nil1.05 × 1041.05 × 104Nil
93.8 × 103Nil8.5 × 1035.8 × 103Nil
104.2 × 103Nil1.12 × 1048.5 × 103Nil

Note – Nil means no count of bacteria

A total of twenty-seven (27) bacterial species were identified from the three different stages of menstrual cycle as five species (L. plantarum (15), L. fermentum (9), Lactobacillus brevis (1), Bacillus safensis (1) and Acetobacter pasteurianus (1)) and their percentage occurrence at different stages of the menstrual cycle was shown in Table I. Twenty-five (25) isolates (92.59%) belonging to the genus Lactobacillus occurred in the three stages, while one (1) isolate (3.70%) each belonged to Bacillus and Acetobacter, both noted during safe (follicular) period, only. The organism with the highest frequency of occurrence (60%) among the Lactobacillus species was L. plantarum and it constituted 55.55% among all the isolates studied, and its highest occurrence was during the ovulation period. L. brevis has the lowest frequency of occurrence of 4% among the Lactobacillus spp. and 3.7% among the total isolates, and it occurred during the menstruation period.

The cell-free supernatants and viable cells showed a clear inhibitory antimicrobial activity against Pseudomonas aeruginosa GF01, Klebsiella sp. GF01 and Staphylococcus sp. GF01. Out of 27 LAB isolates used against P. aeruginosa GF01, 20 (74.07%) of the isolates had zones of inhibition ranging from 8 to 22 mm against Klebsiella sp. GF01, 24 (88.89%) had zones of inhibition ranging from 10 to 20 mm, while 20 (74.07%) had inhibition zones ranging from 10 to 20 mm against Staphylococcus sp. GF01. Staphylococcus sp. GF01 was the least susceptible to the LAB isolated while Klebsiella sp. GF01 was the most susceptible (Table II). After the neutralization of the cell-free supernatant, no obvious antimicrobial activity was observed against the uropathogens.

Determination of the antimicrobial activity of the cell-free supernatant and viable cells.

 Cell-free supernatantViable Cell*
P. aeruginosa GF01Klebsiella sp. GF01Staphylococcus sp. GF01P. aeruginosa GR01Klebsiella sp. GR01Staphylococcus sp. GF01
L. fermentum GF002161220201520
A. pasteurianus GF00420130201812
L. plantarum GF0051514018200
L. fermentum GF006151412182015
L. plantarum GF007201015201518
L. fermentum GF008151515201818
L. plantarum GF009101213192015
L. plantarum GF010201210152020
L. plantarum GF011221317201620
L. fermentum GF01219140202018
L. fermentum GF01322120131820
L. plantarum GF01518100201520
L. plantarum GF01619120202020
L. fermentum GF018192020202015
L. fermentum GF019182016201520
L. brevis GF021192015202020
L. plantarum GF022810002015
L. plantarum GF023100012150
L. fermentum GF024141315121515
L. plantarum GF0251015010180
L. fermentum GF02601800180
L. plantarum GF029000000
L. plantarum GF0300001000
B. safensis GF031013010150
L. plantarum GF03201000100
L. plantarum GF03301818101818
L. plantarum GF03601000120

Antimicrobial activity is expressed as diameters of inhibition zones in mm

The capability of the LAB strains to inhibit the in vitro growth of Staphylococcus sp. GF01 was evaluated in coculture experiment which was carried out in two parts. In the first experiment, L. brevis GF021 was active against Staphylococcus sp. GF01 with 6 log10 reduction after 24 h, had and 5 log10 reduction of Staphylococcus sp. GF01 after incubation with L. fermentum GF002 or L. plantarum GF011. L. fermentum GF019 had a low activity against Staphylococcus sp. GF01, which demonstrated only 3 log10 reduction in numbers of CFU. It was observed that Staphylococcus sp. GF01 did not have an effect on any of the LAB strains (Fig. 1). In the second experiment, Lactobacillus brevis GF021 was active against Staphylococcus sp. GF01 with a 6 log10 reduction. L. fermentum GF002 and L. plantarum GF011 were not active against Staphylococcus sp. GF01 while L. fermentum GF019 showed a low activity against Staphylococcus sp. GF01 with just 1 log10 reduction. L. fermentum GF019 had the least activity and L. brevis GF021 had the highest activity (6 log10 reduction) on Staphylococcus sp. GF01 (Fig. 2).

Fig 1.

Inhibition of in vitro growth of Staphylococcus sp. GF01 by L. brevis GF021, L. fermentum GF002, L. plantarum GF011, and L. fermentum GF019 after 24 h – coincubation.

Fig 2.

Inhibition of in vitro growth of Staphylococcus sp. GF01 by L. brevis GF021, L. fermentum GF002, L. plantarum GF011, and L. fermentum GF019 at 8 and 24 h of coincubation.


The resistance to broad-spectrum antibiotics is a persistent challenge in the management of infections (Ayeni et al. 2011). In this study, Klebsiella sp. GF01, P. aeruginosa GF01 and Staphylococcus sp. GF01 were isolated from urogenital infections. These uropathogens were found to be multidrug resistant, especially Klebsiella sp. GF01, which was completely resistant to all the antibiotics tested in this study. This high phenotypic resistance is making the present antibiotic therapy for bacterial infections ineffective thereby resulting in more search for naturally occurring remedies, e.g. LAB (Ayeni et al. 2011).

The species of beneficial bacteria identified from the vaginal samples in this study were L. fermentum, L. brevis, L. plantarum, B. safensis, and A. pasteurianus. Out of 27 isolates, 25 isolates were lactobacilli where L. plantarum and L. fermentum were the most predominant species, with L. plantarum having the highest occurrence during the ovulation period. Dareng et al. (2016) also reported Lactobacillus iners and Lactobacillus crispatus in the vagina of Nigerian women, while a study of vaginal Lactobacillus strain in the pregnant Korean women reported prevalence of L. crispatus and L. iners, followed by L. gasseri and L. jensenii (Kim et al. 2017). There are versatility and species diversity in the prevalent lactobacilli present in the vagina. This can stem from different lifestyles, geographical and environmental conditions. There is usually a predominance of Lactobacillus in healthy women, including L. iners and L. crispatus in women in the reproductive age (Xu et al. 2013; Ghartey et al. 2014). However, there may be also a complete absence of lactobacilli in the other apparently healthy women. This is in accordance with this study, in which twenty-seven LAB were isolated from the vagina of seven healthy Nigerian women out of the ten volunteers, while no the LAB was detected in three of the women. This result of the LAB absence in women could be due to immunosuppression. Other factors could include infections, stress, nutrition intake, etc.

Many researchers have reported the prevalence of different LAB species isolated from the vagina of women from different geographical area (Gajer et al. 2012; Chaban et al. 2014; Shiraishi et al. 2011), but few have been able to report the type of LAB present or absent during the different stages of a woman’s menstrual cycle in different countries and specific ethnic aspects; this could influence the structure of the microbiota in specific niches. It was observed that during the menstruating period, the LAB count was low while at the safe/follicular period, the presence of the LAB was greater, but a large amount of LAB was found at the latter part of the cycle. Thereby, there was a significant shift in the LAB level from low to high over the course of the menstrual cycle. Menstruation may enhance a distortion of the bacterial microbiota around the vulva (Shiraishi et al. 2011) and influence Lactobacillus spp. which were the dominant organism in most girls before the onset of menses from the early to middle stages of puberty (Hickey et al. 2015).

The absence or low the LAB count during menses may suggest the growth of yeast which can outgrow the bacteria in immunocompromised patients causing yeast and other urogenital infections. However, during safe and ovulation periods when the LAB count is increasing there is a decrease in the yeast count probably due to the antagonistic effect of these LAB on yeast or the hormonal changes taking place during these periods (Relloso et al. 2012). Women may be more susceptible to urogenital tract infections during the menstruation period compared to the ovulation period due to the high prevalence of the LAB during the ovulation period. The dynamic nature of the vaginal environment leads to changes in the microbiota of the vagina as a result of exposure to pathogens and physiologic fluctuations of the menstrual cycle (Farage et al. 2010). In the course of this study, L. plantarum dominated during the ovulation period, L. brevis was found during menstruation and B. safensis during the safe period. The presence of these organisms at different periods can be attributed to change in vagina pH, hormonal change and even the blood flow during menses.

Lactobacilli isolated from the vagina have a prominent role as a prophylactic aimed at improving the vaginal microbiota defense against bacterial infections. The cell-free supernatant and the viable LAB cells exhibited capabilities to inhibit the growth of the uropathogens, albeit to a different extent. The vaginal strains of L. acidophilus had been reported to inhibit the growth of Klebsiella sp. and some other uropathogenic strains (Ayeni and Adeniyi 2012; Adeoshun and Ayeni 2016). Most of the L. plantarum strains showed the most impressive effect. The antagonistic activity of L. brevis GF021 was also appreciable. It was suggested that the organic acid produced by these LAB play a major role in the antagonistic activity because after neutralization, there was no obvious effect. This result agrees with Ayeni et al. (2011) who reported that the antimicrobial properties of LAB are related to their metabolic products such as organic acids and hydrogen peroxide. Non-lactic acid bacterial strains i.e. B. safensis and A. pasteurianus also could inhibit the uropathogens growth. To the best of our knowledge, this is the first study that will report the presence of these two species in the vagina of a woman. B. safensis has biotechnological and industrial potentials (Larboda et al. 2014) while A. pasteurianus is important in vinegar production (Viana et al. 2017). The mechanism by which this organism inhibits the three uropathogens used in this study is probably due to the production of acetic acid.

The resistance of S. aureus strain to the cell-free supernatant from most of the LAB strains in this study prompted another mechanism of antagonism through co-culture experiment. Bamidele et al. (2013) also reported that methicillin-resistant S. aureus (MRSA) strains were resistant to the cell-free supernatants of the LAB but higher activities were shown when the LAB was in contact with the pathogens. Different LAB strains have different rates of the killing of Staphylococcus sp. GF01. In the first experiment, the growth of Staphylococcus sp. GF01 was not influenced by the presence of the lactobacilli while for the second experiment, the 8 h already grown Staphylococcus sp. GF01 overpowered the LAB activity, except for L. brevis. Very good activity demonstrated the strain L. brevis GR01. There was an inhibition (5 log10 reduction) observed only when the pathogen was freshly introduced but no effect was noted towards the 8 h already grown pathogen. The study of Adetoye et al. (2018) reveals a similar process where it was reported that an effective inhibition was observed when the LAB was co-cultured with the pathogens. The presence of the LAB inhibited the growth of Staphylococcus sp. GF01 freshly introduced, while for the already 8 h grown Staphylococcus sp. GF01, the effect of LAB was not obvious, except for L. brevis. It was suggested that Staphylococcus sp. GF01 was able to overpower or suppress the activity of the LAB. The decrease in the number of Staphylococcus sp. GF01 reveals the antimicrobial activity of the LAB cells against Staphylococcus sp. GF01. These data support the result obtained previously using the cell-free supernatant and the viable LAB cells confirming the high resistance of Staphylococcus sp. GF01 to the LAB strains.


The high LAB counts were found during the ovulation period while during menstruation, there was a decrease in the LAB counts. The highest occurrence in the vagina of Nigerian women was shown for L. plantarum that mostly was found during the ovulation period. The LAB isolated has the antimicrobial properties against multidrug-resistant urogenital pathogens what may be applicable in vivo. The fermented foods such as Ogi, yogurt, etc. can be consumed during menstruation in order to replenish the beneficial bacteria. To the best of our knowledge, this is the first study in Nigeria to report a prevalence of the LAB with their protective role at different stages of a woman’s menstrual cycle and also the first study to show the presence of B. safensis and A. pasteurianus in the vagina of a woman.

Fig 1.

Inhibition of in vitro growth of Staphylococcus sp. GF01 by L. brevis GF021, L. fermentum GF002, L. plantarum GF011, and L. fermentum GF019 after 24 h – coincubation.
Inhibition of in vitro growth of Staphylococcus sp. GF01 by L. brevis GF021, L. fermentum GF002, L. plantarum GF011, and L. fermentum GF019 after 24 h – coincubation.

Fig 2.

Inhibition of in vitro growth of Staphylococcus sp. GF01 by L. brevis GF021, L. fermentum GF002, L. plantarum GF011, and L. fermentum GF019 at 8 and 24 h of coincubation.
Inhibition of in vitro growth of Staphylococcus sp. GF01 by L. brevis GF021, L. fermentum GF002, L. plantarum GF011, and L. fermentum GF019 at 8 and 24 h of coincubation.

Determination of the antimicrobial activity of the cell-free supernatant and viable cells.

 Cell-free supernatantViable Cell*
P. aeruginosa GF01Klebsiella sp. GF01Staphylococcus sp. GF01P. aeruginosa GR01Klebsiella sp. GR01Staphylococcus sp. GF01
L. fermentum GF002161220201520
A. pasteurianus GF00420130201812
L. plantarum GF0051514018200
L. fermentum GF006151412182015
L. plantarum GF007201015201518
L. fermentum GF008151515201818
L. plantarum GF009101213192015
L. plantarum GF010201210152020
L. plantarum GF011221317201620
L. fermentum GF01219140202018
L. fermentum GF01322120131820
L. plantarum GF01518100201520
L. plantarum GF01619120202020
L. fermentum GF018192020202015
L. fermentum GF019182016201520
L. brevis GF021192015202020
L. plantarum GF022810002015
L. plantarum GF023100012150
L. fermentum GF024141315121515
L. plantarum GF0251015010180
L. fermentum GF02601800180
L. plantarum GF029000000
L. plantarum GF0300001000
B. safensis GF031013010150
L. plantarum GF03201000100
L. plantarum GF03301818101818
L. plantarum GF03601000120

Evaluation of the LAB counts at different stages of the menstrual cycle.

WeekMenstruation PeriodSafe PeriodOvulation Period
Total CFU/mlLAB CFU/mlTotal CFU/mlLAB CFU/mlTotal CFU/mlLAB CFU/ml
11.02 × 1084.2 × 1071.81 × 10109.3 × 1092.22 × 10101.51 × 1010
25.6 × 1071.0 × 1061.91 × 10105.2 × 1091.90 × 10101.14 × 1010
37.8 × 1071.2 × 1061.89 × 10107.4 × 1092.53 × 10101.51 × 1010
47.0 × 1072.2 × 1061.87 × 10101.89 × 10109.8 × 109
59.2 × 1071.4 × 1061.52 × 10104.2 × 1091.87 × 10101.02 × 1010
66.1 × 1078 × 1058.3 × 1093.0 × 1091.12 × 10107.6 × 109
71.13 × 1082.5 × 1062.11 × 10105.4 × 1093.26 × 10101.02 × 1010
82.0 × 103Nil1.05 × 1041.05 × 104Nil
93.8 × 103Nil8.5 × 1035.8 × 103Nil
104.2 × 103Nil1.12 × 1048.5 × 103Nil

Adeoshun FG, Ayeni FA. Antagonistic effect of four Lactobacillus sp. on multidrug resistant Klebsiella sp. GF01 in coculture. African J Pharm Res Dev. 2016;8:81–87.AdeoshunFGAyeniFAAntagonistic effect of four Lactobacillus sp. on multidrug resistant Klebsiella sp. GF01 in coculture. African J Pharm Res Dev. 2016;8:8187.Search in Google Scholar

Adetoye A, Pinloche E, Adeniyi BA, Ayeni FA. Characterization and anti-salmonella activities of lactic acid bacteria isolated from cattle faeces. BMC Microbiol. 2018 Dec;18(1):96. doi:10.1186/s12866-018-1248-y MedlineAdetoyeAPinlocheEAdeniyiBAAyeniFACharacterization and anti-salmonella activities of lactic acid bacteria isolated from cattle faeces. BMC Microbiol. 2018Dec;18(1):96. doi:10.1186/s12866-018-1248-yMedline611800830165820Open DOISearch in Google Scholar

Agboola FM, Adeniyi BA, Okolo CA, Ogunbanwo TO, Ayeni FA, Lawal TO. Probiotic potentials of Lactic Acid Bacteria isolated from vaginal swabs on selected genital pathogens. IJPSR. 2014;5(7): 2642–2650.AgboolaFMAdeniyiBAOkoloCAOgunbanwoTOAyeniFALawalTOProbiotic potentials of Lactic Acid Bacteria isolated from vaginal swabs on selected genital pathogens. IJPSR. 2014;5(7): 26422650.Search in Google Scholar

Ayeni FA, Adeniyi BA. Antagonistic activities of lactic acid bacteria against organisms implicated in urogenital infections. African J Pharm Res Dev. 2012;4(2):59–69.AyeniFAAdeniyiBAAntagonistic activities of lactic acid bacteria against organisms implicated in urogenital infections. African J Pharm Res Dev. 2012;4(2):5969.Search in Google Scholar

Ayeni FA, Adeniyi BA. Antimicrobial pontentials of Lactic Acid Bacteria isolated from a Nigerian menstruating woman. Turk Silahli Kuvvetleri Koruyucu Hekim Bul. 2013;12(3):283–290. doi:10.5455/pmb.1-1339602984AyeniFAAdeniyiBAAntimicrobial pontentials of Lactic Acid Bacteria isolated from a Nigerian menstruating woman. Turk Silahli Kuvvetleri Koruyucu Hekim Bul. 2013;12(3):283290. doi:10.5455/pmb.1-1339602984Open DOISearch in Google Scholar

Ayeni FA, Sánchez B, Adeniyi BA, de los Reyes-Gavilán CG, Margolles A, Ruas-Madiedo P. Evaluation of the functional potential of Weissella and Lactobacillus isolates obtained from Nigerian traditional fermented foods and cow’s intestine. Int J Food Microbiol. 2011 May;147(2):97–104. doi:10.1016/j.ijfoodmicro.2011.03.014 MedlineAyeniFASánchezBAdeniyiBAde los Reyes-GavilánCGMargollesARuas-MadiedoPEvaluation of the functional potential of Weissella and Lactobacillus isolates obtained from Nigerian traditional fermented foods and cow’s intestine. Int J Food Microbiol. 2011May;147(2):97104. doi:10.1016/j.ijfoodmicro.2011.03.014Medline21482440Open DOISearch in Google Scholar

Bamidele TA, Adeniyi BA, Ayeni FA, Fowora MA, Smith SI. The antagonistic activities of Lactic acid bacteria isolated from Nigerian salad vegetables against methicillin resistant Staphylococcus aureus. Global Res J Microbiol. 2013;3(1):18–23.BamideleTAAdeniyiBAAyeniFAFoworaMASmithSIThe antagonistic activities of Lactic acid bacteria isolated from Nigerian salad vegetables against methicillin resistant Staphylococcus aureus. Global Res J Microbiol. 2013;3(1):1823.Search in Google Scholar

Chaban B, Links MG, Jayaprakash T, Wagner EC, Bourque DK, Lohn Z, Albert AYK, van Schalkwyk J, Reid G, Hemmingsen SM, et al. Characterization of the vaginal microbiota of healthy Canadian women through the menstrual cycle. Microbiome. 2014; 2(1):23. doi:10.1186/2049-2618-2-23 MedlineChabanBLinksMGJayaprakashTWagnerECBourqueDKLohnZAlbertAYK, van SchalkwykJReidGHemmingsenSMCharacterization of the vaginal microbiota of healthy Canadian women through the menstrual cycle. Microbiome. 2014; 2(1):23. doi:10.1186/2049-2618-2-23Medline410621925053998Open DOISearch in Google Scholar

Dareng EO, Ma B, Famooto AO, Akarolo-Anthony SN, Offiong RA, Olaniyan O, Dakum PS, Wheeler CM, Fadrosh D, Yang H, et al. Prevalent high-risk HPV infection and vaginal microbiota in Nigerian women. Epidemiol Infect. 2016 Jan;144(01): 123–137. doi:10.1017/S0950268815000965 MedlineDarengEOMaBFamootoAOAkarolo-AnthonySNOffiongRAOlaniyanODakumPSWheelerCMFadroshDYangHPrevalent high-risk HPV infection and vaginal microbiota in Nigerian women. Epidemiol Infect. 2016Jan;144(01): 123137. doi:10.1017/S0950268815000965Medline465974326062721Open DOISearch in Google Scholar

EUCAST. Enterobacteriaceae: Breakpoint tables for interpretation of MICs and zone diameters. Version 5.0. The European Committee on Antimicrobial Susceptibility Testing. 2015.EUCASTEnterobacteriaceae: Breakpoint tables for interpretation of MICs and zone diameters. Version 5.0. The European Committee on Antimicrobial Susceptibility Testing. 2015.Search in Google Scholar

Farage MA, Miller KW, Sobel JD. Dynamics of the vaginal ecosystem – hormonal influences. Infec Dis Res Treat. 2010;3:1–15.FarageMAMillerKWSobelJDDynamics of the vaginal ecosystem – hormonal influences. Infec Dis Res Treat. 2010;3:115.10.4137/IDRT.S3903Search in Google Scholar

Gajer P, Brotman RM, Bai G, Sakamoto J, Schütte UME, Zhong X, Koenig SSK, Fu L, Ma Z, Zhou X, et al. Temporal dynamics of the human vaginal microbiota. Sci Transl Med. 2012 May 02;4(132):132ra52. doi:10.1126/scitranslmed.3003605 MedlineGajerPBrotmanRMBaiGSakamotoJSchütteUMEZhongXKoenigSSKFuLMaZZhouXTemporal dynamics of the human vaginal microbiota. Sci Transl Med. 2012May 02;4(132):132ra52. doi:10.1126/scitranslmed.3003605Medline372287822553250Open DOISearch in Google Scholar

Ghartey JP, Smith BC, Chen Z, Buckley N, Lo Y, Ratner AJ, Herold BC, Burk RD. Lactobacillus crispatus dominant vaginal microbiome is associated with inhibitory activity of female genital tract secretions against Escherichia coli. PLoS One. 2014 May 7; 9(5):e96659. doi:10.1371/journal.pone.0096659 MedlineGharteyJPSmithBCChenZBuckleyNLoYRatnerAJHeroldBCBurkRDLactobacillus crispatus dominant vaginal microbiome is associated with inhibitory activity of female genital tract secretions against Escherichia coli. PLoS One. 2014May 7; 9(5):e96659. doi:10.1371/journal.pone.0096659Medline401301624805362Open DOISearch in Google Scholar

Graver MA, Wade JJ. The role of acidification in the inhibition of Neisseria gonorrhoeae by vaginal lactobacilli during anaerobic growth. Ann Clin Microbiol Antimicrob. 2011;10(1):8. doi:10.1186/1476-0711-10-8 MedlineGraverMAWadeJJThe role of acidification in the inhibition of Neisseria gonorrhoeae by vaginal lactobacilli during anaerobic growth. Ann Clin Microbiol Antimicrob. 2011;10(1):8. doi:10.1186/1476-0711-10-8Medline304587621329492Open DOISearch in Google Scholar

Gupta K, Grigoryan L, Trautner B. Urinary tract infection. Ann Intern Med. 2017 Oct 03;167(7):ITC49–ITC64. doi:10.7326/AITC201710030 MedlineGuptaKGrigoryanLTrautnerBUrinary tract infection. Ann Intern Med. 2017Oct 03;167(7):ITC49ITC64. doi:10.7326/AITC201710030Medline28973215Open DOISearch in Google Scholar

Hickey RJ, Zhou X, Settles ML, Erb J, Malone K, Hansmann MA, Shew ML, Van Der Pol B, Fortenberry JD, Forney LJ. Vaginal microbiota of adolescent girls prior to the onset of menarche resemble those of reproductive-age women. MBio. 2015 May 01; 6(2):e00097-15. doi:10.1128/mBio.00097-15 MedlineHickeyRJZhouXSettlesMLErbJMaloneKHansmannMAShewMLVan Der PolBFortenberryJDForneyLJVaginal microbiota of adolescent girls prior to the onset of menarche resemble those of reproductive-age women. MBio. 2015May 01; 6(2):e00097-15. doi:10.1128/mBio.00097-15Medline445351325805726Open DOISearch in Google Scholar

Kim JH, Yoo SM, Sohn YH, Jin CH, Yang YS, Hwang IT, Oh KY. Predominant Lactobacillus species types of vaginal microbiota in pregnant Korean women: quantification of the five Lactobacillus species and two anaerobes. J Matern Fetal Neonatal Med. 2017 Oct 02;30(19):2329–2333. doi:10.1080/14767058.2016.1247799 MedlineKimJHYooSMSohnYHJinCHYangYSHwangITOhKYPredominant Lactobacillus species types of vaginal microbiota in pregnant Korean women: quantification of the five Lactobacillus species and two anaerobes. J Matern Fetal Neonatal Med. 2017Oct 02;30(19):23292333. doi:10.1080/14767058.2016.1247799Medline27756178Open DOISearch in Google Scholar

Montanaro L, Ravaioli S, Ruppitsch W, Campoccia D, Pietrocola G, Visai L, Speziale P, Allerberger F, Arciola CR. Molecular characterization of a prevalent ribocluster of methicillin-sensitive Staphylococcus aureus from orthopedic implant infections. correspondence with MLST CC30. Front Cell Infect Microbiol. 2016 Feb 16;6:8. doi:10.3389/fcimb.2016.00008 MedlineMontanaroLRavaioliSRuppitschWCampocciaDPietrocolaGVisaiLSpezialePAllerbergerFArciolaCRMolecular characterization of a prevalent ribocluster of methicillin-sensitive Staphylococcus aureus from orthopedic implant infections. correspondence with MLST CC30. Front Cell Infect Microbiol. 2016Feb 16;6:8. doi:10.3389/fcimb.2016.00008Medline475440726909340Open DOISearch in Google Scholar

Relloso M, Aragoneses-Fenoll L, Lasarte S, Bourgeois C, Romera G, Kuchler K, Corbí AL, Muñoz-Fernández MA, Nombela C, Rodríguez-Fernández JL, et al. Estradiol impairs the Th17 immune response against Candida albicans. J Leukoc Biol. 2012 Jan;91(1):159–165. doi:10.1189/jlb.1110645 MedlineRellosoMAragoneses-FenollLLasarteSBourgeoisCRomeraGKuchlerKCorbíALMuñoz-FernándezMANombelaCRodríguez-FernándezJLEstradiol impairs the Th17 immune response against Candida albicans. J Leukoc Biol. 2012Jan;91(1):159165. doi:10.1189/jlb.1110645Medline21965175Open DOISearch in Google Scholar

Shiraishi T, Fukuda K, Morotomi N, Imamura Y, Mishima J, Imai S, Miyazawa K, Taniguchi H. Influence of menstruation on the microbiota of healthy women’s labia minora as analyzed using a 16S rRNA gene-based clone library method. Jpn J Infect Dis. 2011;64(1):76–80. MedlineShiraishiTFukudaKMorotomiNImamuraYMishimaJImaiSMiyazawaKTaniguchiHInfluence of menstruation on the microbiota of healthy women’s labia minora as analyzed using a 16S rRNA gene-based clone library method. Jpn J Infect Dis. 2011;64(1):7680. Medline10.7883/yoken.64.76Search in Google Scholar

Viana RO, Magalhães-Guedes KT, Braga RA Jr, Dias DR, Schwan RF. Fermentation process for production of apple-based kefir vinegar: microbiological, chemical and sensory analysis. Braz J Microbiol. 2017 Jul;48(3):592–601. doi:10.1016/j.bjm.2016.11.006 MedlineVianaROMagalhães-GuedesKTBragaRAJrDiasDRSchwanRFFermentation process for production of apple-based kefir vinegar: microbiological, chemical and sensory analysis. Braz J Microbiol. 2017Jul;48(3):592601. doi:10.1016/j.bjm.2016.11.006Medline549842228283415Open DOISearch in Google Scholar

Xu S, Zong L, Liu M, He Y, Huang X, Zhou H. [Illumina sequencing 16S rRNA tagging reveals diverse vaginal microbiomes associated with bacterial vaginosis] (in Chinese). Nan Fang Yi Ke Da Xue Xue Bao. 2013 May;33(5):672–677 MedlineXuSZongLLiuMHeYHuangXZhouH[Illumina sequencing 16S rRNA tagging reveals diverse vaginal microbiomes associated with bacterial vaginosis] (in Chinese). Nan Fang Yi Ke Da Xue Xue Bao. 2013May;33(5):672677MedlineSearch in Google Scholar

Recommended articles from Trend MD

Plan your remote conference with Sciendo