Open Access

Analysis of the role of Dirofilaria repens macrophage migration inhibitory factors in host–parasite interactions

, , , , ,  and   
Sep 23, 2024

Cite
Download Cover

Fig. 1.

Sodium dodecyl sulphate–polyacrylamide gel electrophoresis analysis of purified recombinant Dirofilaria repens (rDre)-macrophage migration inhibitory factor (MIF)-1 (left) and rDre-MIF-2 (right). Lane M – molecular weight marker; Lane 1 – rDre-MIF-1 (10 μL); Lane 2 – rDre-MIF-2 (10 μL)
Sodium dodecyl sulphate–polyacrylamide gel electrophoresis analysis of purified recombinant Dirofilaria repens (rDre)-macrophage migration inhibitory factor (MIF)-1 (left) and rDre-MIF-2 (right). Lane M – molecular weight marker; Lane 1 – rDre-MIF-1 (10 μL); Lane 2 – rDre-MIF-2 (10 μL)

Fig. 2.

Dirofilaria repens macrophage migration inhibitory factor (Dre-mif)-1 and Dre-mif-2 gene expression in microfilariae and the adult stage of D. repens. The fold increase in expression is shown over the level of expression of Dre-mif-1 in microfilariae. Statistical analysis was performed using one-way analysis of variance; **** – P-value <0.001
Dirofilaria repens macrophage migration inhibitory factor (Dre-mif)-1 and Dre-mif-2 gene expression in microfilariae and the adult stage of D. repens. The fold increase in expression is shown over the level of expression of Dre-mif-1 in microfilariae. Statistical analysis was performed using one-way analysis of variance; **** – P-value <0.001

Fig. 3.

Alignment of human macrophage migration inhibitory factor (hMIF), dog MIF (dMIF), Dirofilaria repens (Dre)-MIF-1 and Dre-MIF-2 amino acid sequences
Alignment of human macrophage migration inhibitory factor (hMIF), dog MIF (dMIF), Dirofilaria repens (Dre)-MIF-1 and Dre-MIF-2 amino acid sequences

Fig. 4.

The visualisation of superimposed potential structures of Dirofilaria repens (Dre)-macrophage migration inhibitory factor (MIF)-1 (red) and Dre-MIF-2 (blue). The complete structures are shown on fragments A) and C), whereas matching helices and strands are respectively shown on fragments B) and D)
The visualisation of superimposed potential structures of Dirofilaria repens (Dre)-macrophage migration inhibitory factor (MIF)-1 (red) and Dre-MIF-2 (blue). The complete structures are shown on fragments A) and C), whereas matching helices and strands are respectively shown on fragments B) and D)

Fig. 5.

Reactivity of mouse anti-recombinant Dirofilaria repens (rDre)-macrophage migration inhibitory factor (MIF)-1 and anti-rDre-MIF-2 sera with rDre-MIF-1 and rDre-MIF-2. Serum dilutions for detection: immunoglobulin (Ig)G, IgG1, IgG2 and IgM – 1 : 51,200; IgE – 1 : 5,120. OD – optical density
Reactivity of mouse anti-recombinant Dirofilaria repens (rDre)-macrophage migration inhibitory factor (MIF)-1 and anti-rDre-MIF-2 sera with rDre-MIF-1 and rDre-MIF-2. Serum dilutions for detection: immunoglobulin (Ig)G, IgG1, IgG2 and IgM – 1 : 51,200; IgE – 1 : 5,120. OD – optical density

Fig. 6.

Western blot cross-reactivity analysis of mouse anti-recombinant Dirofilaria repens (rDre)-macrophage migration inhibitory factor (MIF)-1 (A) and anti-rDre-MIF-2 (B) antibodies with rDre-MIF-1 and rDre-MIF-2
Western blot cross-reactivity analysis of mouse anti-recombinant Dirofilaria repens (rDre)-macrophage migration inhibitory factor (MIF)-1 (A) and anti-rDre-MIF-2 (B) antibodies with rDre-MIF-1 and rDre-MIF-2

Fig. 7.

Reactivity of different serum antibody classes in infected and non-infected dogs with recombinant Dirofilaria repens (rDre)-macrophage migration inhibitory factor (MIF)-1 and rDre-MIF-2. Serum dilutions for detection: immunoglobulin (Ig) G, IgG1, and IgG2 – 1 : 400; IgM – 1 : 3,200; IgE – 1 : 20. Statistical analysis was performed using the Mann–Whitney test; * – P-value <0.05; *** – P-value <0.001
Reactivity of different serum antibody classes in infected and non-infected dogs with recombinant Dirofilaria repens (rDre)-macrophage migration inhibitory factor (MIF)-1 and rDre-MIF-2. Serum dilutions for detection: immunoglobulin (Ig) G, IgG1, and IgG2 – 1 : 400; IgM – 1 : 3,200; IgE – 1 : 20. Statistical analysis was performed using the Mann–Whitney test; * – P-value <0.05; *** – P-value <0.001

Primers used in the reverse-transcriptase quantitative PCR to amplify Dirofilaria repens macrophage migration inhibitory factor (Dre-mif)-1 and -2

Primer Sequence
Dre-mif-1_F 5′GGCTGATGAACT CAAAAT CCC 3′
Dre-mif-1_R 5′ACCCATTGCCGAAGCACTAATA 3′
Dre-mif-2_F 5′GATTGGATCATTTTCGGCTGATA 3′
Dre-mif-2_R 5′CGTACCATTGCATCCCACATTT 3′

The protein identity between human macrophage migration macrophage migration inhibitory factor (hMIF), dog MIF (dMIF), Dirofilaria repens (Dre)-MIF-1 and Dre-MIF-2

Protein hMIF dMIF Dre-MIF-1 Dre-MIF-2
hMIF - 93.9% 41.7% 27.8%
dMIF 93.9% - 40.0% 26.9%
Dre-MIF-1 41.7% 40.0% - 27.8%
Dre-MIF-2 27.8% 26.9% 27.8% -
Language:
English