Open Access

Enterovirus E infects bovine peripheral blood mononuclear cells. Implications for pathogenesis?

, ,  and   
Dec 19, 2023

Cite
Download Cover

Fig. 1.

Representative dot plot cytograms showing distribution of the main lymphocyte subsets of bovine peripheral blood mononuclear cells after 72 h incubation with a high infectious dose of enterovirus E (EV-E): panel (A) unstimulated cells; (B) concanavalin A-stimulated cells; (C) lipopolysaccharide-stimulated cells. In each panel: upper row – control (uninfected) cells, bottom row – EV-E-infected cells; columns from left to right: lymphocyte gating based on their forward and side scatter (FSC/SSC) properties, T-cell gating according to the expression of CD4 and CD8 markers, B-cell gating according to the expression of CD21 marker and gamma-delta-cell gating according to the expression of WC1 marker
Representative dot plot cytograms showing distribution of the main lymphocyte subsets of bovine peripheral blood mononuclear cells after 72 h incubation with a high infectious dose of enterovirus E (EV-E): panel (A) unstimulated cells; (B) concanavalin A-stimulated cells; (C) lipopolysaccharide-stimulated cells. In each panel: upper row – control (uninfected) cells, bottom row – EV-E-infected cells; columns from left to right: lymphocyte gating based on their forward and side scatter (FSC/SSC) properties, T-cell gating according to the expression of CD4 and CD8 markers, B-cell gating according to the expression of CD21 marker and gamma-delta-cell gating according to the expression of WC1 marker

Immunophenotyping of bovine peripheral blood lymphocytes cultured for 72 h in the presence of enterovirus E, n = 5

Population Unstimulated LPS-stimulated ConA-stimulated
C EV-E (MOI) C EV-E (MOI) C EV-E (MOI)
10 1 0.1 10 1 0.1 10 1 0.1
CD4+CD8− 44.80±8.73 44.86±6.30 42.98±6.93 42.46±7.24 19.38±3.15 34.55**±6.53 31.02*±5.99 38.30***±5.05 45.98±10.56 47.48±9.67 45.30±7.44 42.24±7.33
CD4-CD8+ 22.20±0.92 20.28±1.53 21.58±2.53 22.10±1.92 12.72±4.66 23.30*±5.86 22.22*±6.17 24.05*±5.80 13.36±4.18 19.54±9.54 13.21±5.96 14.45±5.74
CD4+CD8+ 0.97±0.38 1.92±0.88 1.17±0.40 1.04±0.18 2.89±0.61 6.09±2.16 5.83±2.61 6.90±3.27 2.39±0.68 7.34**±4.05 2.93±0.82 2.31±0.50
CD21+ 15.38±8.23 21.96±6.49 20.30±8.61 19.59±8.30 47.86±9.94 16.39***±8.63 19.71***±9.12 11.53***±5.86 18.55±6.67 9.49±4.88 18.46±5.31 17.66±9.02
WC1+ 4.31±3.01 1.80±1.40 5.29±3.66 5.81±4.57 4.28±1.94 2.28±1.48 3.45±1.78 3.32±0.99 16.98±10.99 18.86±12.10 14.53±9.16 13.55±9.18

Serum anti-EV-E antibody titres, intracellular viral RNA levels and extracellular virus titres from bovine PBMCs

Parameter Individual
1 2 3 4 5 6 7 8 9 10
anti-EV-E antibody titer in serum ND 1:40 1:20 1:80 1:20 1:40 1:80 1:40 1:20 1:160
extracellular virus titer (log CCID50/1 mL) 3.625 1.75 3.25 3.125 3.875 3.125 2.125 3.625 2.75 3.125
intracellular viral RNA (copy number/μL of RNA) 13.39 37.48 1.866 4913 7.133 14.82 3.852 54740 20.1 9.610

Enterovirus E effect on the viability and blastogenic response of bovine peripheral blood mononuclear cells to mitogens shown by the MTT reduction assay, n=10

Parameter C EV-E (MOI)
10 1 0.1
viability (%) 100±0 58.928**±19.969 80.927±20.681 104.685±31.217
proliferation ConA (SI) 4.332±0.957 2.198***±0.731 4.712±1.274 3.960±0.779
proliferation LPS (SI) high responders 2.085±0.46 1.479***±0.152 1.212***±0.298 1.095***±0.255
proliferation LPS (SI) low responders 0.924±0.112 1.084±0.120 0.925±0.160 0.880±0.140

Cytokine levels in supernatants from bovine peripheral blood mononuclear cells cultured for 72 h in the presence of enterovirus E, n = 5

Cytokine (pg/mL) Unstimulated LPS-stimulated
C EV-E (MOI) C EV-E (MOI)
10 1 0.1 10 1 0.1
IL-1β 3.56±2.38 62.09***±13.39 96.55***±17.96 24.67*±5.97 21.81±6.46 5.35**±3.81 24.36±4.95 17.53±7.21
IL-6 89.32±53.37 141.89±84.48 784.94***±284.26 864.22***±82.46 1292.09±279.69 1209.51±179.79 1151.45±167.52 1152.22±197.26
TNF-α 129.09±84.32 207.14±90.41 1057.82***±441.88 1236.32***±96.40 1780.26±456.88 2037.78±550.99 1684.56±363.51 1682.79±356.02

Monoclonal antibodies used in the study

Marker Expressed by Fluorochrome Clone Isotype
CD4 subset of T cells FITC CC8 IgG2a
CD8 subset of T cells Alexa Fluor 647 CC63 IgG2a
WC1 gamma/delta (γδ) T cells FITC CC15 IgG2a
CD21 B cells RPE CC51 IgG2b

Primer sequences used for the detection of intracellular enterovirus E RNA

Primer Primer sequence (5′–3′) Amplicon size GenBank accession No.
EV-E802 forward AAAGGGGGCTGTCGAAACCA 802 DQ092769.1
EV-E 802 reverse GCTAGTGGGCTCAGACTCCG
EV-E 183 forward TACGCCTTTCGTGGCTTGGA 183
EV-E 183 reverse TTGCTTTTCCTGGCTTGCCG

Oxidative burst activity of bovine peripheral blood phagocytes after 3 h incubation with enterovirus E, n = 5

Cell type Parameter C EV-E (MOI)
10 1 0.1
granulocytes % 91.62 ± 4.3 92.18 ± 3.98 92.94 ± 3.86 92.76 ± 4.23
MFI 1797.6 ± 269.67 1774.6 ± 291.22 1831.4 ± 280.50 1793.8 ± 286.99
monocytes % 43.32 ± 7.70 32.62 ± 3.74 35.90 ± 6.94 37.46 ± 6.65
MFI 299.2 ± 87.04 208.4 ± 71.53 240.2 ± 74.89 247.2 ± 93.38
Language:
English