Enterovirus E infects bovine peripheral blood mononuclear cells. Implications for pathogenesis?
Dec 19, 2023
About this article
Published Online: Dec 19, 2023
Page range: 517 - 527
Received: Jun 02, 2023
Accepted: Oct 17, 2023
DOI: https://doi.org/10.2478/jvetres-2023-0061
Keywords
© 2023 Joanna Małaczewska et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1.

Immunophenotyping of bovine peripheral blood lymphocytes cultured for 72 h in the presence of enterovirus E, n = 5
Population | Unstimulated | LPS-stimulated | ConA-stimulated | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
C | EV-E (MOI) | C | EV-E (MOI) | C | EV-E (MOI) | |||||||
10 | 1 | 0.1 | 10 | 1 | 0.1 | 10 | 1 | 0.1 | ||||
CD4+CD8− | 44.80 |
44.86 |
42.98 |
42.46 |
19.38 |
34.55 |
31.02 |
38.30 |
45.98 |
47.48 |
45.30 |
42.24 |
CD4-CD8+ | 22.20 |
20.28 |
21.58 |
22.10 |
12.72 |
23.30 |
22.22 |
24.05 |
13.36 |
19.54 |
13.21 |
14.45 |
CD4+CD8+ | 0.97 |
1.92 |
1.17 |
1.04 |
2.89 |
6.09 |
5.83 |
6.90 |
2.39 |
7.34 |
2.93 |
2.31 |
CD21+ | 15.38 |
21.96 |
20.30 |
19.59 |
47.86 |
16.39 |
19.71 |
11.53 |
18.55 |
9.49 |
18.46 |
17.66 |
WC1+ | 4.31 |
1.80 |
5.29 |
5.81 |
4.28 |
2.28 |
3.45 |
3.32 |
16.98 |
18.86 |
14.53 |
13.55 |
Serum anti-EV-E antibody titres, intracellular viral RNA levels and extracellular virus titres from bovine PBMCs
Parameter | Individual | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | |
anti-EV-E antibody titer in serum | ND | 1:40 | 1:20 | 1:80 | 1:20 | 1:40 | 1:80 | 1:40 | 1:20 | 1:160 |
extracellular virus titer (log CCID50/1 mL) | 3.625 | 1.75 | 3.25 | 3.125 | 3.875 | 3.125 | 2.125 | 3.625 | 2.75 | 3.125 |
intracellular viral RNA (copy number/μL of RNA) | 13.39 | 37.48 | 1.866 | 4913 | 7.133 | 14.82 | 3.852 | 54740 | 20.1 | 9.610 |
Enterovirus E effect on the viability and blastogenic response of bovine peripheral blood mononuclear cells to mitogens shown by the MTT reduction assay, n=10
Parameter | C | EV-E (MOI) | ||
---|---|---|---|---|
10 | 1 | 0.1 | ||
viability (%) | 100 |
58.928 |
80.927 |
104.685 |
proliferation ConA (SI) | 4.332 |
2.198 |
4.712 |
3.960 |
proliferation LPS (SI) high responders | 2.085 |
1.479 |
1.212 |
1.095 |
proliferation LPS (SI) low responders | 0.924 |
1.084 |
0.925 |
0.880 |
Cytokine levels in supernatants from bovine peripheral blood mononuclear cells cultured for 72 h in the presence of enterovirus E, n = 5
Cytokine (pg/mL) | Unstimulated | LPS-stimulated | ||||||
---|---|---|---|---|---|---|---|---|
C | EV-E (MOI) | C | EV-E (MOI) | |||||
10 | 1 | 0.1 | 10 | 1 | 0.1 | |||
IL-1β | 3.56 |
62.09 |
96.55 |
24.67 |
21.81 |
5.35 |
24.36 |
17.53 |
IL-6 | 89.32 |
141.89 |
784.94 |
864.22 |
1292.09 |
1209.51 |
1151.45 |
1152.22 |
TNF-α | 129.09 |
207.14 |
1057.82 |
1236.32 |
1780.26 |
2037.78 |
1684.56 |
1682.79 |
Monoclonal antibodies used in the study
Marker | Expressed by | Fluorochrome | Clone | Isotype |
---|---|---|---|---|
CD4 | subset of T cells | FITC | CC8 | IgG2a |
CD8 | subset of T cells | Alexa Fluor 647 | CC63 | IgG2a |
WC1 | gamma/delta (γδ) T cells | FITC | CC15 | IgG2a |
CD21 | B cells | RPE | CC51 | IgG2b |
Primer sequences used for the detection of intracellular enterovirus E RNA
Primer | Primer sequence (5′–3′) | Amplicon size | GenBank accession No. |
---|---|---|---|
EV-E802 forward | AAAGGGGGCTGTCGAAACCA | 802 | DQ092769.1 |
EV-E 802 reverse | GCTAGTGGGCTCAGACTCCG | ||
EV-E 183 forward | TACGCCTTTCGTGGCTTGGA | 183 | |
EV-E 183 reverse | TTGCTTTTCCTGGCTTGCCG |
Oxidative burst activity of bovine peripheral blood phagocytes after 3 h incubation with enterovirus E, n = 5
Cell type | Parameter | C | EV-E (MOI) | ||
---|---|---|---|---|---|
10 | 1 | 0.1 | |||
granulocytes | % | 91.62 ± 4.3 | 92.18 ± 3.98 | 92.94 ± 3.86 | 92.76 ± 4.23 |
MFI | 1797.6 ± 269.67 | 1774.6 ± 291.22 | 1831.4 ± 280.50 | 1793.8 ± 286.99 | |
monocytes | % | 43.32 ± 7.70 | 32.62 ± 3.74 | 35.90 ± 6.94 | 37.46 ± 6.65 |
MFI | 299.2 ± 87.04 | 208.4 ± 71.53 | 240.2 ± 74.89 | 247.2 ± 93.38 |