Open Access

Antimicrobial resistance and virulence genes in staphylococci isolated from aviary capercaillies and free-living birds in south-eastern Poland


Cite

Introduction

Bacteria of the Staphylococcus genus are widespread in nature. They are often isolated from water, soil and air. Most species of staphylococci are saprophytes, which are part of the natural microbiota of humans and animals, but they are also important aetiological factors of infections and food poisoning (8). Bacteria of this genus can produce numerous virulence factors, including surface proteins essential for the colonisation process and extracellular toxins responsible for the destruction of tissues and inactivation of host defence mechanisms (2). Coagulase-positive staphylococci are not very numerous but are quite diverse. The most important species of the genus, in terms of its ability to cause infections in humans and animals, is the coagulase-positive Staphylococcus aureus (9, 20). Currently recognised S. aureus toxins include 22 enterotoxins, toxic shock syndrome toxin (TSST-1), exfoliatin (A and B) and Panton–Valentine leukocidin (PVL), a pore-forming cytotoxin that targets human and rabbit mononuclear and polymorphonuclear cells. Some of these factors are capable of stimulating nonspecific T-cell proliferation and possess superantigenic activity. They are encoded by plasmids, prophages, pathogenicity islands, genomic islands, or genes located on the chromosome next to the staphylococcal cassette (SCC) containing methicillin resistance genes (22, 29, 33, 38). A single bacterial strain may produce any of these toxins separately or in various combinations (8). Coagulase-negative staphylococci (CNS) inhabit the gastrointestinal tract and respiratory system and are present as physiological microbiota on the skin and mucous membranes of humans and animals. Their virulence is determined by the bacterial cell structures as well as substances and structures produced extracellularly but integrally connected with the cell, e.g. adhesins (8). Coagulase-negative staphylococci have traditionally been considered commensals; however, many CNS species are now recognised as potential opportunistic pathogens and important reservoirs of antibiotic resistance genes and virulence factors that can be transferred to closely related species such as S. aureus (2, 12). Staphylococcus epidermidis, referred to as a microorganism “on the verge of pathogenicity and commensalism”, is currently considered one of the most important coagulase-negative species (8). Due to the impact of infections with CNS species in both humans and animals, research interest in them has increased over the past decade (24, 38). All species of birds, both farmed and wild, may suffer from Staphylococcus infections. Birds are most often infected through damaged skin, resulting in local inflammatory changes in the skin (dermatitis) and subcutaneous tissue (cellulitis) (1, 21). Infections may also occur via the gastrointestinal tract or the aerogenic route. The occurrence and pathogenicity of staphylococci have been widely studied in poultry species (15, 20, 24). While the toxigenic potential of coagulase-negative staphylococci was questioned in older reports, more recent scientific articles provide information on the presence of toxigenic genes in these staphylococcal species (2, 6, 12, 30). Still little is known about the occurrence and pathogenicity of these bacteria in wild bird species, especially endangered species such as the western capercaillie (Tetrao urogallus L. 1758, in the Phasianidae family and Galliformes order).

The western capercaillie is a large forest bird found in temperate forests of Europe (including Russia), with a geographic range stretching from the Alps, the Pyrenees, and the Balkans to northern Norway. It has long been a focus of interest of naturalists and hunters. According to the European Union Birds Directive (2009/147/EC), the capercaillie is a species of conservation interest because of the population decline observed in various parts of its distribution. It is considered to be an umbrella species for other mountain birds (37). In Poland it is one of the most important game species in national forests. The population and areas of occurrence of the capercaillie are currently declining because of the destruction and fragmentation of old forests, urbanisation and development of tourism infrastructure, agricultural expansion, predation, hunting pressure, poaching, and water pollution. The perilous state of the population throughout Poland has led to aviary breeding of capercaillies.

The aim of the study was to determine the frequency of the Staphylococcus spp. occurrence in samples collected from dead capercaillies kept in aviaries, and samples taken from other free-living bird species, as well as to conduct a phenotypic and genotypic evaluation of the virulence factors of the isolated strains.

Material and Methods

Birds. The samples were collected from dead free-living birds from the Podkarpackie province and from capercaillies living in the adaptation aviary in the Vistula Forest District near Żywiec and from the Capercaillie Breeding Centre in the Leżajsk Forest District near Krosno, all locations in Poland. Samples were taken from 73 dead capercaillies (adult birds, chicks and embryos). The wild birds belonged to 10 orders and 15 species: Ciconiiformes (white stork, Ciconia ciconia, n = 35), Galliformes (common pheasant, Phasianus colchicus, n = 46; black grouse, Lyrurus tetrix, n = 2), Strigiformes (tawny or brown owl, Strix aluco, n = 10), Falconiformes (common kestrel, Falco tinnunculus, n = 8), Anseriformes (mute swan, Cygnus olor, n = 5), Passeriformes (song thrush, Turdus philomelos, n = 5; common blackbird, Turdus merula, n = 7; meadow pipit, Anthus pratensis, n = 5; and fieldfare, Turdus pilaris, n = 4), Piciformes (great spotted woodpecker, Dendrocopos major, n = 4), Pelecaniformes (grey heron, Ardea cinerea, n = 2), Apodiformes (common swift, Apus apus, n = 4), and Accipitriformes (common buzzard, Buteo buteo, n = 3; and lesser spotted eagle, Clanga pomarina, n = 1). The samples were collected from November 2019 to June 2021. The internal organs of dead birds (heart, liver and spleen), tarsal joints and conjunctival and palatal fissure swabs collected during necropsies and unhatched capercaillie embryos were placed in transport media and transported to the laboratory under refrigerated conditions (Table 1).

Total number of birds and number and type of organs from which bacteria of the genus Staphylococcus were isolated

Number of Staphylococcus strains isolated from individual organs or tissue
Bird species Total examined animals Heart Liver Spleen Tarsal joint Conjunctiva Palatal fissure Yolk sac Dead embryo
Capercaillie (Tetrao urogallus) 73 5 5 9 4 5 7 9 13
White stork (Ciconia ciconia) 35 3 3 5 3 7 6 - -
Common pheasant(Phasianus colchicus) 46 1 3 6 1 5 4 2 -
Tawny owl (Strix aluco) 10 - 1 2 - 1 2 - -
Common kestrel (Falco tinnunculus) 8 1 - 2 - - 2 - -
Common blackbird (Turdus merula) 7 - - - 1 1 2 - -
Mute swan (Cygnus olor) 5 - 1 - - 1 1 - -
Song thrush (Turdus philomenos) 5 - - 1 - - 2 - -
Grey heron (Ardea cinerea) 2 - 1 - - - - - -
Great spotted woodpecker (Dendrocopos major) 4 - - 1 - - - - -
Common buzzard (Buteo buteo) 3 - - - - - - - -
Black grouse (Lyrurus tetrix) 2 - - - - - - - -
Common swift (Apus apus) 4 - - - - - - - -
Meadow pipit (Anthus pratensis) 5 - - - - - - - -
Fieldfare (Turdus pilaris) 4 - - - - - - - -
Lesser spotted eagle (Clanga pomarina) 1 - - - - - - - -
Total 214 10 14 26 9 20 26 11 13

Identification of bacterial strains. The collected material was plated on a blood agar medium (Blood LAB-AGAR; Biocorp, Warsaw, Poland) and Chapman selective medium (Mannitol Salt LAB-AGAR; Biocorp) and incubated under aerobic conditions at 37℃ for 24–48 h, depending on the rate of growth of the bacteria. Single colonies were transferred to blood agar to isolate pure bacterial cultures, and a preliminary bacteriological characterisation of the isolated bacteria was made, involving Gram staining, microscope examination of cell morphology and motility, and determination of the type of haemolysis. Quantitative measurement of the colonies was not performed. The isolated bacteria were stored for further testing at −85°C in 50% (v/v) glycerol in brain heart infusion broth (BHI; Sigma-Aldrich, St. Louis, MO, USA).

All Staphylococcus strains were identified by matrix-assisted laser desorption/ionization (MALDI)– time-of-flight mass spectrometry using the IVD MALDI Biotyper (Bruker Daltonik, Bremen, Germany), as described by Marek et al. (20).

Susceptibility to antibiotics. Susceptibility to 13 antibiotics was tested by a standard disc diffusion method on Mueller–Hinton agar plates (CM0337B; Oxoid, Ely, UK) using a bacterial suspension with turbidity adjusted to a 0.5 McFarland standard. The susceptibility of bacteria was determined for the following agents: amoxicillin 25 μg (AML25); amoxicillin + clavulanic acid 20 + 10 μg (AMC30); ampicillin 10 μg (AMP10); penicillin G 10 units (P10); cefoxitin 30 μg (FOX30); clindamycin 2 μg (DA2); chloramphenicol 30 μg (C30); erythromycin 15 μg (E15); gentamicin 10 μg (CN10); tetracycline 30 μg (TE30); trimethoprim–sulfamethoxazole 1:19, 25 μg (SXT25); enrofloxacin 5 μg (ENR5); and fusidic acid 5 μg (FD5) (Oxoid). Strains were assigned to susceptible (S), intermediate resistant (I), or resistant (R) categories on the basis of the Guidelines for Susceptibility Testing (37). Resistance rates were calculated as the number of intermediate and resistant isolates divided by the total number of isolates. The analysis of resistance (patterns of resistance) of Staphylococcus strains to eight classes of antibiotics (β-lactam, macrolides, aminoglycosides, fluoroquinolones, phenicols, tetracyclines, dihydrofolate reductase inhibitor and fusidic acid) was performed. For quality control, S. aureus ATCC 25923, S. aureus ATCC43300 and S. aureus ATCC 29213 were used in the disc diffusion tests.

Bacterial DNA extraction. Bacteria were stimulated to grow by inoculating them on blood agar with defrosted brain heart infusion broth suspension and glycerol and incubating them at 37°C for 24 h. Single colonies were then inoculated in tryptone soya broth (TSB) medium, (CM0129, Oxoid, Ely, UK), at 37°C for 12 h. Cells from the culture grown overnight in TSB medium were collected by centrifugation at 8,000 rpm at 10°C for 15 min and then the supernatant was discarded. Then the pellet was washed twice with normal saline and centrifuged at 8,000 rpm at 10°C for 15 min. Subsequently, the GeneMatrix Bacterial & Yeast Genomic DNA Purification Kit (EURx, Gdańsk, Poland) protocol was followed.

The obtained bacterial DNA was stained with ethidium bromide, agarose gel electrophoresis was performed, and finally the fluorescence of the preparations was compared with that of a preparation of known concentration.

Detection of resistance genes. The PCR primers for the antibiotic resistance genes mecA, mecC, blaZ, ermA, ermB, ermC, tetK, tetM, tetL, tetO, msrA/B, aac (6′)/aph (2ʺ), norA, cfr, and mphC were designed by Genomed (Warsaw, Poland) and are listed in Table 2.

Nucleotide sequences and sizes of PCR products of amplified genes

Gene Oligonucleotide sequence (5′-3′) Amplicon size (bp) PCR conditions Reference
mecA AAAATCGATGGTAAAGGTTGGC AGTTCTGGCACTACCGGATTTGC 533 94℃, 5 min, 40 cycles of 94℃ for 1 min, 58℃ for 1 min, 72℃ for 2 min, final extension 72℃ for 5 min (23)
mecC GAA AAA AAG GCT TAG AAC GCC TC GAA GAT CTT TTC CGT TTT CAG C 138 94℃, 15 min, 30 cycles of 94℃ for 30 s, 59℃ for 1 min, 72℃ for 1 min, final extension for 10 min (35)
blaZ ermA ACTTCAACACCTGCTGCTTTC TAGGTTCAGATTGGCCCTTAG TCT AAAAAG CATGTAAAAGAA TGA TTATAATTATTT GATAGC TTC 173 645 95℃, 3 min, 30 cycles of 95℃ for 30 s, 54℃ for 30 s, 72℃ for 30 s, final extension 72℃ for 4 min (7)
ermB TAACGACGAAACTGGCTAAAA ATCTGTGGTATGGCGGGTAAG 416 95℃, 3 min, 30 cycles of 95℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, final extension 72℃ for 5 min (36)
ermC TAATCGTGGAATACGGGTTTG AATCGTCAATTCCTGCATGT 299
tetK GTAGCGACAATAGGTAATAGT GTAGTGACAATAAACCTCCTA 360
tetM CATATGTCCTGGCGTGTCTA AGTGGAGCGATTACAGAA 158 94℃, 5 min, 30 cycles of 94℃ for 1 min, 57℃ for 1 min, 72℃ for 1 min, (18)
tetL ATAAATTGTTTCGGGTCGGTAAT AACCAGCCAACTAATGACAATGAT 1077 final extension 72℃ for 5 min
tetO AACTTAGGCATTCTGGCTCAC TCCCACTGTTCCATATCGTCA 514
msrA/B GCAAATGGTGTAGGTAAGACAACT ATCATGTGATGTAAACAAAAT 399 95℃, 3 min, 35 cycles of 93℃ for 30 s, 55℃ for 2 min, 74℃ for 1 min, final extension 72℃ 90 s (36)
Aac(6′)/aph(2ʺ) CAGAGCCTTGGGAAGATGAAG CCTCGTGTAATTCATGTTCTGGC 348 94℃, 10 min, 35 cycles of 94℃ for 45 s, 60℃ for 60 s, 72℃ for 60 s, final extension cycle 72℃ for 5 min (39)
norA TTTGTTTTCAGTGTCAGAATTTATGTTTG GGCTTGGTGAAATATCAGCTATTAAAC 140 94℃, 5 min, 30 cycles of 94℃ for 30 s, 60℃ for 30 s, 72℃ for 60 s, final extension 72℃ for 5 min (26)
cfr TGA AGT ATA AAG CAG GTT GGG AGT CA ACC ATA TAA TTG ACC ACA AGC AGC 746 94℃, 2 min, 30 cycles of 94℃ for 30 s, 45℃ for 30 s, and 72℃ for 45 s, final extension 72℃ for 1 min (13)
mphC GAG ACT ACC AAG AAG ACC TGA CG CAT ACG CCG ATT CTC CTG AT 530 95℃, 5 min, 35 cycles of 94℃ for 1 min, 59℃ for 1 min, 72℃ for 2 min, final extension 72℃ for 1 min (16)
sea TGCATGTTTTCAGAGTTAATC ACGATCAATTTTTACAGC 544
seb TCTTTGTCGTAAGATAAACTTC GAATGATATTAATTCGCATC 416 94℃, 5 min, 35 cycles of 94℃ for 2 min, 57℃ for 2 min, 72℃ for 1 min, (22)
sec GACATAAAAGCTAGGAATTT AAATCGGATTAACATTATCCA 257 final extension 72℃ for 7 min
sed TTACTAGTTTGGTAATATCTCCTT CCACCATAACAATTAATGC 334
see ATAGATAAAGTTAAAACAAGCAA TAACTTACCGTGGACCC 170
tst ACCCCTGTTCCCTTATCATC TTTTCAGTATTTGTAACGCC 326
pvl ATCATTAGGTAAAATGTCTGGACATGATCCA GCATCAASTGTATTGGATAGCAAAAGC 433 95℃, 5 min, 30 cycles of 94℃ for 1 min, 55℃ for 30 s, 72℃ for 1 min, (38)
eta GCAGGTGTTGATTTAGCATT AGATGTCCCTATTTTTGCTG 93 final extension at 72℃ for 5 min
etb ACAAGCAAAAGAATACAGCG GTTTTTGGCTGCTTCTCTTG 226

An internal control was integrated into each PCR to verify the efficiency of the amplification and to ensure that there was no significant PCR inhibition.

Genotypic analysis of virulence. All isolates were screened for the presence of nine virulence genes by PCR amplification with the primers listed in Table 2 used at 0.04 μmol concentration. The following determinants were tested: staphylococcal enterotoxins A to E (sea, seb, sec, sed and see), toxic shock syndrome toxin 1 (tst), exfoliative toxins A and B (eta and etb) and Panton– Valentine leukocidin (pvl). The conditions of the multiplex PCR reaction followed those from the studies by Garofalo et al. (7), Kehrenberg and Schwarz (13), Luthje and Schwarz (16), Malhotra-Kumar et al. (18), Murakami et al. (23), Stegger et al. (35), Sutcliffe et al. (36), Ünal and Çinar (38), and Vakulenko et al. (39). For quality control, S. aureus ATCC43300; S. aureus ATCCBAA-2312; S. haemolyticus 955; E. faecium PE1, S. pyogenes 7020, E. faecium ET18, E. faecalis JH2-2TET, S. aureus RN4220, S. aureus MSSA476, ATCC29213, and CCRI-8926; S. aureus FRI913; ATCC13566; S. aureus FRI151m; S. aureus FRI1169, CCM7056; and S. aureus 16575 were used in the PCR reactions.

Phenotypic antimicrobial resistance of Staphylococcus strains

Antibiotic
Species AML25 AMC30 AMP10 P10 FOX30 DA2 C30 E15 CN10 TE30 SXT25 ENR5 FD5
S. sciuri, n = 56 R 15 8 18 16 14 2 2 - 1 15 3 26 28
I - - - - - 12 - 5 1 1 - - -
S. xylosus, n = 14 R 3 2 3 3 1 - 2 4 - 6 2 6 6
I - - - - - 1 1 2 - - - - -
S. equorum, n = 12 R 1 - 1 1 1 1 2 2 - 3 1 1 2
I - - - - - - - 3 1 - - - -
S. saprophyticus, n = 8 R - 1 2 1 - - - 5 - 7 2 5 1
I - - - - - - - - - - - - -
S. aureus, n = 6 R 1 4 4 4 - - - - - - - 3 1
I - - - - - 3 - 4 - - - - -
S. epidermidis, n = 6 R 1 1 4 3 - 3 - 4 - 4 5 5 -
I - - - - - - - - - - - - -
S. cohnii, n = 6 R 3 1 3 2 3 2 - 3 - 3 2 3 2
I - - - - - 1 - 2 1 - - - -
S. pseudintermedius, n = 3 R 1 1 1 1 - 1 1 1 - 1 - 1 -
I - - - - - - - 1 - - - - -
S. haemolyticus, n = 3 R 1 - 2 2 1 1 - 1 1 1 2 1 1
I - - - - - - - - - - - - -
S. lentus, n = 3 R - - - - - - - - - 1 - 1 1
I - - - - - - - - - - - - -
S. kloosii, n = 2 R - - 1 - - - - - - 1 - - 1
I - - - - - - - 1 - - - - -
S. succinus, n = 2 R - - - - - - - 1 - - - - -
I - - - - - - - - - - - - -
S. vitulinus, n = 2 R - 1 1 1 1 - - 1 - - - 1 1
I - - - - - - - - - - - - -
S. condimenti, n =1 R 1 - 1 1 1 1 1 - - - - 1 1
I - - - - - - - 1 1 1 1 - -
S. nepalensis, n = 1 R - - - - - - - - - 1 - 1 -
I - - - - - - 1 - - - - - -
S. arlettae, n = 1 R - - - 1 - - - 1 - 1- 1 1
I - - - - - - - - - - - - -
S. pasteuri, n = 1 R - - 1 - - - - - - - - - -
I - - - - - - - - - - - - -
S. chromogenes, n = 1 R 1 1 1 1 1 1 - 1 - 1 1 1 1
I - - - - - - - - - - - - -
S. warneri, n = 1 R - - - - - - - - - - - - -
I - - - - - - - - - - - - -
Total number 28 20 43 37 23 29 9 43 6 47 19 57 47
% 21.7 15.5 33.3 28.7 17.8 22.5 7.0 33.3 4.7 36.4 14.7 44.2 36.4

AML25 – amoxicillin 25 μg; AMC30 – amoxicillin + clavulanic acid 20 + 10 μg; AMP10 – ampicillin 10 μg; P10 – penicillin G 10 units; FOX30 – cefoxitin 30 μg; DA2 – clindamycin 2 μg; C30 – chloramphenicol 30 μg; E15 – erythromycin 15 μg; CN10 – gentamicin 10 μg; TE30 – tetracycline 30 μg; SXT25 – trimethoprim–sulfamethoxazole 1:19, 25 μg; ENR5 – enrofloxacin 5 μg; FD5 – fusidic acid 5 μg

Percentage of Staphylococcus strains isolated from individual bird species resistant to specific antibacterial agents

Bird species Number of strains Antibiotic
AML25 AMC30 AMP10 P10 FOX30 DA2 C30 E15 CN10 TE30 SXT25 ENR5 FD5
Capercaillie (Tetrao urogallus) 57 12 21% 7 12.3% 21 36.8% 18 31.6% 9 15.8% 23 40.4% 4 7% 19 33.3% 4 7% 14 24.6% 11 19.3% 26 45.6% 20 35.1%
White stork (Ciconia ciconia) 27 5 18.5% 3 11.1% 6 22.2% 5 18.5% 5 18.5% 3 11.1% 2 7.4% 9 33.3% 1 3.7% 12 44.4% 3 11.1% 9 33.3% 12 44.4%
Common pheasant (Phasianus colchicus) 22 10 45.5% 8 36.4% 12 54.5% 11 50.0% 7 31.8% 3 13.6% 3 13.6% 11 50.5% - 20 90/9% 5 22.7% 18 81.8% 11 50.5%
Tawny owl (Strix aluco) 6 - - 1 16.7% - - - - 1 16.7% - 1 16.7% - - 1 16.7%
Common kestrel (Falco tinnunculus) 5 - - - - - - - 20.01 % - - - 20.01 % 20.01 %
Common blackbird (Turdus merula) 4 - - - - - - - - - - - - -
Mute swan (Cygnus olor) 3 1 33.3% 1 33.3% 2 66.6% 2 66.6% 2 66.6% - - - - - - 2 66.6% 1 33.3%
Song thrush (Turdus philomenos) 3 - 1 33.3% 1 33.3% 1 33.3% - - - 1 33.3% - - - 1 33.3% 1 33.3%
Grey heron (Ardea cinerea) 1 - - - - - - - 1 100% 1 100% - - - -
Great spotted woodpecker (Dendrocopus major) 1 - - - - - - - - - - - - -

AML25 – amoxicillin 25 μg; AMC30 – amoxicillin+clavulanic acid 20 + 10 μg; AMP10 – ampicillin 10 μg; P10 – penicillin G 10 units; FOX30 – cefoxitin 30 μg; DA2 – clindamycin 2 μg; C30 – chloramphenicol 30 μg; E15 – erythromycin 15 μg; CN10 – gentamicin 10 μg; TE30 – tetracycline 30 μg; SXT25 – trimethoprim–sulfamethoxazole 1:19, 25 μg; ENR5 – enrofloxacin 5 μg; FD5 – fusidic acid 5 μg. The resistance rate was calculated as the number of intermediate and resistant isolates divided by the total number of isolates

Results

Occurrence of Staphylococcus species. A total of 129 bacterial strains belonging to the genus Staphylococcus were isolated from the internal organs of 214 capercaillies and free-living birds. The Staphylococcus strains isolated from the samples belonged to 19 species. Coagulase-negative strains accounted for 93%, while the remaining 7% were coagulase-positive species.

The percentages of strains belonging to each species were as follows: S. sciuri 43.4%, S. xylosus 10.8%, S. equorum 9.3%, S. saprophyticus 6.2%, S. aureus 4.7%, S. epidermidis 4.7%, S. cohnii 4.7%, S. lentus 2.3%, S. haemolyticus 2.3%, S. pseudintermedius 2.3%, S. succinus 1.5%, S. kloosii 1.5%, S. vitulinus 1.5%, S. condimenti 0.8%, S. nepalensis 0.8%, S. arlettae 0.8%, S. pasteuri 0.8%, S. chromogenes 0.8%, and S. warneri 0.8%. The total numbers of Staphylococcus strains (and their percentages) isolated from the capercaillies and other bird species are presented in Table 4.

Susceptibility to antibiotics. Testing of the susceptibility of the isolated strains to 13 selected antimicrobial agents indicated 5 antibiotics and chemotherapeutic agents to which more than 30% of strains showed resistance. These were enrofloxacin (44.2% resistant strains), fusidic acid and tetracycline (36.4% for both), and erythromycin and ampicillin (33.3% for both).

In addition, there were three more antibiotics to which more than 20% of staphylococcal strains showed resistance: penicillin G, clindamycin and amoxicillin. The lowest percentage of resistant strains (less than 10%) was observed in the case of gentamicin and chloramphenicol. Detailed data are presented in Table 3. Analysis of the resistance patterns of isolated strains showed that as many as 14 (10.8%) of them were resistant to five or more of the classes of antimicrobial agents used. These were six strains isolated from capercaillies, four isolated from storks, and four isolated from pheasants. Of the 129 Staphylococcus strains tested for antibiotic susceptibility, 33 (25.6%) showed no resistance to any of the 13 antimicrobials. The antimicrobial resistance patterns of the isolates are shown in Table 5.

Multidrug resistance profiles of isolated Staphylococcus strains

Species of bird Number of Staphylococcus (% strains of all isolated strains) Phenotypic resistance combination pattern (number of classes of antimicrobial agents) Number of strains
no resistance 10
β-lactams (1) 6
macrolides (1) 7
fusidic acid (1) 6
fluoroquinolones (1) 1
fusidic acid, fluoroquinolones (2) 5
phenicols, tetracyclines (2) 1
fluoroquinolones, β-lactams (2) 1
fluoroquinolones, fusidic acid, β-lactams (3) 2
fluoroquinolones, macrolides, β-lactams (3) 2
macrolides, β-lactams, tetracyclines (3) 2
fluoroquinolones, fusidic acid, tetracyclines (3) 1
Capercaillie fluoroquinolones, fusidic acid, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4) 1
(Tetrao urogallus) 57 (44.2) fluoroquinolones, tetracyclines, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, fusidic acid, β-lactams, tetracyclines (4) 1
fluoroquinolones, fusidic acid, β-lactams, macrolides (4) 1
fluoroquinolones, tetracyclines, macrolides, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, macrolides, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, aminoglycosides, β-lactams, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, macrolides, β-lactams, tetracyclines, phenicols (5) 1
fluoroquinolones, macrolides, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5) 2
fluoroquinolones, macrolides, β-lactams, Fusidic acid, aminoglycosides, sulfonamide + dihydrofolate reductase inhibitor (6) 1
fluoroquinolones, macrolides, β-lactams, Fusidic acid, aminoglycosides, tetracyclines, phenicols, sulfonamide + dihydrofolate reductase inhibitor (8) 2
no resistance 7
β-lactams (1) 1
macrolides (1) 1
tetracyclines (1) 2
sulfonamide + dihydrofolate reductase inhibitor (1) 1
macrolides, tetracyclines (2) 2
Fusidic acid, tetracyclines (2) 3
Fusidic acid, fluoroquinolones (2) 1
macrolides, β-lactams (2) 1
White stork (Ciconia ciconia) 27 (20.9) fusidic acid, fluoroquinolones, tetracyclines (3) fusidic acid, fluoroquinolones, β-lactams (3) 1 1
fusidic acid, fluoroquinolones, β-lactams, macrolides (4) 1
fusidic acid, fluoroquinolones, macrolides, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fusidic acid, fluoroquinolones, macrolides, β-lactams, tetracyclines (5) 1
fusidic acid, fluoroquinolones, macrolides, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5) 1
fusidic acid, fluoroquinolones, macrolides, β-lactams, tetracyclines, phenicols (6) 1
fusidic acid, fluoroquinolones, aminoglycosides, β-lactams, tetracyclines, phenicols (6) 1
no resistance 1
phenicols (1) 1
β-lactams, tetracyclines (2) 1
fluoroquinolones, macrolides, tetracyclines (3) 4
macrolides, β-lactams, tetracyclines (3) 1
fluoroquinolones, β-lactams, tetracyclines (3) 1
fluoroquinolones, macrolides, fusidic acid, tetracyclines (4) 2
fluoroquinolones, β-lactams, fusidic acid, tetracyclines (4) 4
Common pheasant fluoroquinolones, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (4) 1
(Phasianus colchicus) 22 (17.1) fluoroquinolones, fusidic acid, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (4) 1
fluoroquinolones, β-lactams, tetracyclines, macrolides (4) 1
fluoroquinolones, fusidic acid, tetracyclines, macrolides, phenicols (5) 1
fluoroquinolones, fusidic acid, β-lactams, tetracyclines, sulfonamide + dihydrofolate reductase inhibitor (5) 1
fluoroquinolones, fusidic acid, β-lactams, tetracyclines, macrolides, sulfonamide + dihydrofolate reductase inhibitor (6) 1
fluoroquinolones, fusidic acid, β-lactams, tetracyclines, macrolides, phenicols, sulfonamide + dihydrofolate reductase inhibitor (7) 1
Tawny owl no resistance 4
6 (4.6) β-lactams (1) 1
(Strix aluco) macrolides, fusidic acid, tetracyclines (3) 1
Common kestrel 5 (3.9) no resistance 4
(Falco tinnunculus) fluoroquinolones, fusidic acid, macrolides (3) 1
Common blackbird (Turdus merula) 4 (3.1) no resistance 4
no resistance 1
Mute swan 3 (2.3) fluoroquinolones, β-lactams (2) 1
(Cygnus olor) fluoroquinolones, β-lactams, fusidic acid (3) 1
Song thrush no resistance 1
(Turdus 3 (2.3) fluoroquinolones, fusidic acid (2) 1
philomelos) β-lactams, macrolides (2) 1
Grey heron (Ardea cinerea) 1 (0.8) macrolides, aminoglycosides (2) 1
Great spotted woodpecker (Dendrocopos major) 1 (0.8) no resistance 1

Antimicrobial resistance genes. All isolates were tested for the presence of genes encoding resistance to methicillin, beta-lactamase, tetracycline, macrolide-lincosamide-streptogramin B (MLSB), aminoglycoside and florfenicol/chloramphenicol. The results are presented in Table 6.

Presence of genes encoding resistance to antimicrobial agents and staphylococcal toxins in isolated strains

Staphylococcus species
Gene S. sci (n=56) S. xyl (n=14) S. equ (n=12) S. sap (n=8) S. aur (n=6) S. epi (n=6) S. coh (n=6) S. pse (n=3) S. hae (n=3) S. len (n=3) S. klo (n=2) S. suc (n=2) S. vit (n=2) S. con (n=1) S. nep (n=1) S. arl (n=1) S. pas (n=1) S. chr (n=1) S. war (n=1) Total %
mecA 7 1 1 9 7.0
mecC
blaZ 2 3 2 4 2 1 1 1 16 12.4
msrA/B 3 2 3 3 1 1 2 1 1 17 13.2
ermA 5 1 6 4.7
ermB 12 1 2 1 2 2 1 21 16.3
ermC 7 3 5 1 5 3 1 1 1 27 20.9
tetK 19 5 4 5 2 4 4 2 2 1 1 49 38.0
tetM 16 7 5 3 3 1 1 1 1 1 1 40 31.0
tetL 5 1 1 7 5.4
tetO 3 1 1 1 1 7 5.4
cfr 1 1 1 1 1 5 3.9
norA 6 2 1 1 6 2 1 1 20 15.5
aac(6′)/ aph(2ʺ) 3 1 1 1 1 7 5.4
mphC 7 5 3 2 2 2 1 1 23 17.8
sea 1 1 1 3 2.3
seb
sec
sed
see
pvl
eta
etb
tst 1 1 0.8
129

S. sciStaphylococcus sciuri; S. xylStaphylococcus xylosus; S. equStaphylococcus equorum; S. sapStaphylococcus saprophyticus; S. aurStaphylococcus aureus; S. epiStaphylococcus epidermidis; S. cohStaphylococcus cohnii; S pseStaphylococcus pseudintermedius; S. haeStaphylococcus haemolyticus; S. lenStaphylococcus lentus; S. kloStaphylococcus kloosii; S. sucStaphylococcus succinus; S. vitStaphylococcus vitulinus; S. conStaphylococcus condimenti; S. nepStaphylococcus nepalensis; S. arlStaphylococcus arlettae; S. pasStaphylococcus pasteuri; S. chrStaphylococcus chromogenes; S. warStaphylococcus warneri

Of the 129 Staphylococcus strains, 9 had the mecA gene: 7/56 S. sciuri, 1/6 S. cohnii and 1/2 S. vitulinus. The presence of the blaZ gene determining resistance to β-lactam antibiotics was demonstrated in 16 strains. The msrA/B gene encoding an ATP-dependent efflux pump was harboured by 17 strains. The three erythromycin ribosomal methylase genes, ermA, ermB and ermC, were demonstrated in 6, 21 and 27 strains, respectively. The presence of the mphC gene was noted in 23 strains. In the case of tetracycline resistance genes, tetK was demonstrated in 49 strains and tetM in 40 strains, while the tetL and tetO genes were each found in 7 strains. Carriage of the aminoglycoside resistance gene aac (6′)/aph (2ʺ) was observed in 7 strains (belonging to the species S. xylosus, S. equorum, S. cohnii, S. haemolyticus and S. lentus). The presence of the florfenicol/chloramphenicol resistance gene (cfr) and quinolone resistance gene (norA) was demonstrated in 5 and 20 strains, respectively.

Prevalence of toxin genes in Staphylococcus isolates. The results of multiplex PCR for the five classical enterotoxins A–E showed that the genome of three strains (of S. xylosus, S. aureus and S. cohnii) contained the gene sea, responsible for the production of enterotoxin A. None of the Staphylococcus strains had the genes responsible for the production of enterotoxins B, C, D or E. Similarly, none of the strains had the eta, etb or pvl gene responsible for the production of exfoliatin (A and B) and Panton–Valentine leukocidin. One strain of S. sciuri, isolated from a pheasant, showed the presence of the tst gene responsible for the production of toxic shock syndrome toxin (TSST-1).

Discussion

In the present study, high species diversity (n = 19) was detected among staphylococci recovered from capercaillies and free-living bird species, S. sciuri (43.4%) predominating followed by S. xylosus (10.8%). Staphylocccus sciuri constituted more than half of the strains isolated from capercaillies and almost 40% of the strains isolated from storks and pheasants (37% and 36.4%, respectively). Single strains of S. sciuri were isolated from the remaining bird species. Of all staphylococci isolated from storks, Staphylocccus xylosus strains comprised 22.7%. A small percentage of S. xylosus strains was also isolated from capercaillies and pheasants (5.3% and 3.7%, respectively), and single strains of S. xylosus were isolated from the remaining bird species (blackbirds, kestrels and owls). Staphylocccus equorum was the species of 18.2% of all staphylococci isolated from pheasants and 10.5% of all staphylococci isolated from capercaillies; individual strains of this species were also isolated from storks and swans. Pheasant isolates were S. saprophyticus in 27.3% of cases and stork isolates were this species in 7.4% of detections. The remaining coagulase-negative Staphylococcus species each accounted for less than 10% of the total isolates (Table 3). Strains of S. epidermidis were isolated only from capercaillies and storks, while S. cohnii strains were isolated from these birds and pheasants in addition. Only two coagulase-positive species were isolated: S. aureus, which constituted 4.6% of all isolates, and S. pseudintermedius (2.3%). Staphylococcus aureus strains were isolated from three capercaillies, a thrush, a kestrel and a stork, while all three S. pseudintermedius isolates were derived from capercaillies. It is not possible to make a direct comparison of the prevalence of staphylococci obtained in this study with other reports, because studies on the prevalence of staphylococci in capercaillies are almost inexistent. Data in the available literature show that S. sciuri was also the most frequent CNS species in cloacal or tracheal samples from wild birds in other regions of the world (21, 30). Many authors indicate that this species has a broad host range and is adapted to highly varied habitats (10, 19, 24, 31). The second most frequently recovered species in this study, S. xylosus, was especially prevalent among capercaillies, pheasants and blackbirds. This species has also been recovered from birds of prey in Portugal. In that study, S. saprophyticus, S. epidermidis, S. haemolyticus and S. succinus, recognised as opportunistic pathogens in human infections, represented 6.2%, 4.6%, 2.3% and 1.5% respectively of the total isolates recovered from wild birds (34).

Knowledge of the antimicrobial phenotype and genotype of staphylococci in natural ecosystems is very important because these bacteria can act as vectors of antimicrobial resistance mechanisms. In the present study, 44.2% of isolates showed resistance to enrofloxacin, which was the highest percentage of resistant strains among all antimicrobials used in the study. A high percentage of quinolone resistance (25% of S. aureus and 66.6% of S. hyicus strains) was observed by Vidala et al. (40) among strains isolated from free-living raptors in Catalonia, Spain. The highest percentage of strains resistant to enrofloxacin in the study described here (81.8%) was isolated from pheasants. In addition, 36.4% of the isolated strains showed resistance to tetracycline and 33.3% to erythromycin; in these cases similarly the highest percentage of resistant strains was found among isolates from pheasants (90.9% and 50%, respectively). In a study on CNS isolates from wild birds in Spain by Ruiz-Ripa et al. (31), the percentage of tetracycline- and erythromycin-resistant strains was less than 10%. Staphylococci isolated from free-living raptors from Catalonia did not show resistance to tetracycline, while all isolated strains of S. hyicus showed resistance to doxycycline (40). Beta-lactam antibiotics (penicillins, cephalosporins, monobactams and carbapenems) are very important drugs because of their effective and broad mode of action against various bacterial pathogens in combination with their low toxicity in humans and animals (25). In our study, the highest percentages of strains resistant to β-lactam antibiotics were demonstrated for ampicillin (33.3%), penicillin G (28.7%), and clindamycin (22.5%). Also, a relatively high percentage of staphylococcal strains were resistant to amoxicillin (21.7%). Similarly, other authors have shown a high percentage of resistance to penicillin G and ampicillin among staphylococcal strains isolated from wild birds and free-living raptors in Spain (31, 40). In the research presented in this article, as in the cases mentioned above, the highest percentage of resistance to β-lactam antibiotics was observed among the strains isolated from pheasants. The high percentage of strains isolated from pheasants showing resistance to certain antibiotics may be related to the fact that some free-living pheasants were reared in aviaries by hunting clubs and then released into the environment. Presumably, birds reared in aviaries undergo prophylactic treatments and receive antibiotic therapy in case of health problems.

Resistance to enrofloxacin and β-lactam antibiotics (penicillin G, cefoxitin and clindamycin) was also observed in two of the three strains isolated from mute swans. Fourteen (10.8%) of the Staphylococcus isolates exhibited simultaneous resistance to five or more classes of antimicrobial agents, which is referred to as multi-drug resistance (MDR) (17) (Table 5). Strains resistant to five or more classes of antibiotics were isolated from capercaillies (six strains), storks (four strains) and pheasants (four strains). The results of the antimicrobial susceptibility test of coagulase-negative staphylococci from healthy free-ranging birds in Spain showed that as many as 34% isolates were resistant to at least three different classes of antimicrobial agents (31). This represents an important source of transmission of pathogens and its antimicrobial resistance mechanisms to other species of animals. The occurrence of drug-resistant bacterial strains in free-living birds and aviary capercaillies in our research may be related to the geographical area and the presence of farms, mainly poultry farms. The use of antimicrobials in intensive production is a common practice. In addition, capercaillies kept in aviaries are under the care of a veterinarian, and in the provision of that care antimicrobial agents are used with high frequency, enabling the emergence of MDR bacteria. Another risk factor for drug resistant bacteria dissemination is that other animals, such as rodents, small birds (e.g. passerines) or insects that might come into contact with animal farms or open wastewater drains could be contaminated with MDR pathogens and become both disseminators and sources of infection for wild birds and capercaillies in aviaries.

Some species of staphylococci from animal sources are considered reservoirs of resistance genes. The mecA gene, the major determinant of methicillin resistance in staphylococci, is found in both Staphylococcus aureus and coagulase-negative staphylococci (11). Molecular detection of mecA, typically by polymerase chain reaction (PCR), is regarded as the gold standard for the confirmation of methicillin resistance. Methicillin-resistant strains of S. aureus (MRSA) have been isolated from birds, including poultry, domestic pigeons and parrots, and wild birds (1). In our study, the presence of the mecA gene was detected in nine (7%) Staphylococcus strains, which were isolated from pheasants (three strains), storks (three strains), swans (two strains) and a capercaillie (one strain). The mecA gene was only detected in coagulase-negative species (Table 6). Recent studies have shown the existence of a novel mecA homologue gene for methicillin resistance (mecC), which has been detected in bacteria isolated from humans and farm animals in many European countries, as well as in companion and wild animals. Cattle populations have been recognised as reservoirs for mecC strains (9, 10, 28). Interestingly, the mecC gene has rarely been reported in bird species. Although in recent years, it has been detected in S. aureus isolates from wild chaffinches in Scotland and white storks in Spain (10, 27), the presence of the mecC gene was not demonstrated in the present study in any Staphylococcus strain isolated from capercaillies or other birds.

The blaZ gene was detected in 12.4% (16/129) of isolates and in both coagulase-positive and coagulase-negative kinds. Interestingly, none of the strains analysed showed the presence of both the blaZ and mecA genes simultaneously. The differences in the resistance percentage between the phenotypic tests of resistance to cefoxitin and the detection of the mecA gene (17.8% phenotypic resistance vs 7% mecA-positive staphylococci isolates) reflect the heterogeneous expression of β-lactam resistance in Staphylococcus isolates from wild bird sources.

The tetK and tetM genes, with or without tetL and tetO, generally mediated tetracycline resistance in our study, the phenotype with this resistance being one of the most frequently detected (36.4%). Research on coagulase-negative staphylococci from wild birds in Spain showed that tetracycline resistance was especially high among S. lentus isolates (60%) and was mediated by the tetK, tetL and/or tetM genes (31). Tetracycline is one of the most commonly used antibiotic classes in food animals (5). In a study by Larsen et al. (14), the prevalence of tetM and tetK in livestock-associated MRSA in Denmark in 1999–2011 was 99% and 89%, respectively.

Macrolide and lincosamide resistance is mediated by various combinations of erm, msr, mphC and other genes. The frequency of the ermA, ermB, and ermC genes in Staphylococcus strains varies depending on the geographic location and the population from which the strains are isolated. In a population of 493 human macrolide-resistant MRSAs, Schmitz et al. (32) found that 82.4% of them contained the ermA gene. In contrast, only 4.6% of Staphylococcus strains isolated in by the present authors had the erythromycin-resistance gene ermA. The ermC gene was present in the highest percentage (20.7%) of the analysed strains. In addition, 17.8% of the strains had the mphC gene and 16.3% had the ermB gene.

The presence of sea, seb, sec, sed and see, responsible for the production of staphylococcal enterotoxins A, B,C, D and E, respectively, was also analysed in our study. The sea and see genes are carried in prophages, whereas sed, the determinant of toxin D, is of plasmid origin. The seb gene, responsible for toxin B production, can be of chromosomal origin or carried by plasmids (22, 33). Our study showed the presence of the gene responsible for the production of enterotoxin A (sea) in 3 strains of the S. cohnii, S. xylosus and S. aureus species. These strains were isolated from pheasants, owls and thrushes, respectively. The genes responsible for the production of the remaining enterotoxins (B–E) were not shown in any of the analysed strains. Cunha et al. (2) observed that S. epidermidis and S. lugdunensis were the most toxigenic species among the CNS in their study. Some reports indicate that TSST-1 is also produced by CNS (2, 12). In our study, the presence of the tst gene, responsible for the production of toxic shock syndrome toxin, was demonstrated in one strain of S. sciuri which was isolated from a capercaillie which had died in the first 24 hours of life. A recent study by Ruiz-Ripa et al. (31) on coagulase-negative staphylococci from wild birds in Spain found that two S. sciuri isolates recovered from cinereous vultures carried the tst gene. Staphylococcus sciuri is not considered to be particularly pathogenic to animals, but its danger is apparently increasing. Research indicates that it can cause various infections, such as endocarditis, peritonitis, septic shock, urinary tract infections and wound infections, in both animals and humans (3).

According to Schmitz et al. (33), Staphylococcus strains that are positive for toxigenic gene detection could be regarded as having potential for toxin production. Besides their noting of toxigenicity in S. epidermidis and S. lugdunensis, Cunha et al. (2) also observed the production of some toxins, i.e. TSST-1, SEB and SEC, by isolated S. epidermidis and S. aureus strains producing enterotoxins A, B and C, although the presence of these genes was not confirmed by PCR. The PCR technique can detect genes contained in genetic lines, irrespective of their expression (2). Although the gene is present in the microorganism, it may not always be active. Only expression of the mRNA sequence (determined by RT-PCR) which encodes toxin synthesis leaves no doubt as to the microorganism’s toxic potential.

Among the staphylococcal species isolated from the aviary capercaillies and free-living birds, the vast majority were coagulase negative. Both coagulase-positive and coagulase-negative staphylococci have significant pathogenic potential. It seems, however, that the most important role is played by virulence factors associated with increasing drug resistance, including raising the incidence of multi-resistant strains.

The relatively high percentage of Staphylococcus strains showing a significant degree of resistance to fluoroquinolones, tetracyclines, macrolides and β-lactams, as well as the presence of the tetK, tetM, ermC, mphC and mecA genes, reveals their importance for public health and zoonotic potential. The potential for the transfer of antibiotic resistant bacteria from wildlife or the environment to humans and domestic animals should not be underestimated. Coagulase-negative staphylococci seem to be natural reservoirs of methicillin-resistant genes, even in environments with very low antimicrobial selection pressure. The isolation of S. sciuri, S. xylosus and S. cohnii strains with genes encoding enterotoxin A and toxic shock syndrome toxin indicates that CNS are also important pathogens with toxigenic potential. This underscores the need to pay greater attention to these microorganisms, which are still often considered mere contaminants.

eISSN:
2450-8608
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine