Cite

Fig. 1

Histopathological examination and data analysis. A – infiltration of cancer cells into the lymphatic vessels (arrows); scale bar: 200 μm. B – immunostaining with cytokeratin 1/3 antibody showing cancer cells with infiltration into the lymphatic vessels to be of epithelial origin (arrows); scale bar: 200 μm. C – IMC-1 cells with epithelial characteristics as polygonal or circular shapes and arranged in a paving stone pattern without contact inhibition; scale bar: 100 μm. D – cell proliferation rate indicating 31 h doubling time. E and F – flow cytometric investigation of expression of CD24 and CD44 in IMC-1. Values represent the mean ± standard error (n = 6)
Histopathological examination and data analysis. A – infiltration of cancer cells into the lymphatic vessels (arrows); scale bar: 200 μm. B – immunostaining with cytokeratin 1/3 antibody showing cancer cells with infiltration into the lymphatic vessels to be of epithelial origin (arrows); scale bar: 200 μm. C – IMC-1 cells with epithelial characteristics as polygonal or circular shapes and arranged in a paving stone pattern without contact inhibition; scale bar: 100 μm. D – cell proliferation rate indicating 31 h doubling time. E and F – flow cytometric investigation of expression of CD24 and CD44 in IMC-1. Values represent the mean ± standard error (n = 6)

Fig. 2

Expression of xCT visualised by Western blot, flow cytometry and immunofluorescence. A – Western blot showing an xCT band in both IMC-1 cells and the positive controls (MDA-MB-231) and lower band intensity when IMC-1 cells were treated with SSZ at concentrations of 50 μM and 100 μM for 24 h. B – proportion of control and IMC-1 cells expressing xCT seen in flow cytometry. C – fluorescence microscopy of xCT expression by IMC-1 showing xCT throughout the cytoplasm to the cell surface. Values represent the mean ± standard error (n = 6). Scale bar: 100 μm
Expression of xCT visualised by Western blot, flow cytometry and immunofluorescence. A – Western blot showing an xCT band in both IMC-1 cells and the positive controls (MDA-MB-231) and lower band intensity when IMC-1 cells were treated with SSZ at concentrations of 50 μM and 100 μM for 24 h. B – proportion of control and IMC-1 cells expressing xCT seen in flow cytometry. C – fluorescence microscopy of xCT expression by IMC-1 showing xCT throughout the cytoplasm to the cell surface. Values represent the mean ± standard error (n = 6). Scale bar: 100 μm

Fig. 3

Expression levels of the NANOG, MYC, SOX2, and KLF4 CSC markers before and after SSZ treatment as determined by semi-quantitative PCR. A – bar charts showing significant differences in MYC, SOX2, and KLF4 expression between the SSZ-treated and the untreated cells. B – dot plot showing greater aldehyde dehydrogenase (ALDH) activity in experimental cells than in control cells but lower activity in SSZ-treated cells than in untreated cells. Red dotted area is calculated by control cells and represents cells with ALDH activity. C – bar chart showing a significant decrease in the number of positive cells after treatment with SSZ; ns – not significant; * p < 0.05. Values represent the mean ± standard error (n = 6).
Expression levels of the NANOG, MYC, SOX2, and KLF4 CSC markers before and after SSZ treatment as determined by semi-quantitative PCR. A – bar charts showing significant differences in MYC, SOX2, and KLF4 expression between the SSZ-treated and the untreated cells. B – dot plot showing greater aldehyde dehydrogenase (ALDH) activity in experimental cells than in control cells but lower activity in SSZ-treated cells than in untreated cells. Red dotted area is calculated by control cells and represents cells with ALDH activity. C – bar chart showing a significant decrease in the number of positive cells after treatment with SSZ; ns – not significant; * p < 0.05. Values represent the mean ± standard error (n = 6).

Primers used in this study

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
NANOG TGGAACAATCCGCTCCACAA GATGGACTCCAGATCACCCATAGAA
MYC GATCTCCTCCGGAGAGTGGAAAC CACCGAGTCGTAGTCGAGGTCAT
SOX2 GTGAGCGCCTGCAGTACAA GCGAGTAGGACATGCTGTAGGTG
KLF4 GATGTGACCCACACTGCCAGA TGTTGGGAACTTGACCATGATTGTA
HPRT1 GGAGCATAATCCAAAGATGGTCAA TCAGGTTTATAGCCAACACTTCGAG
eISSN:
2450-8608
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine