Open Access

Genetic and pathogenic characterisation of a virulent Akabane virus isolated from goats in Yunnan, China


Cite

Fig. 1

Histopathological images of baby hamster kidney (BHK)-21 cells infected with Akabane virus strain CX01. A – Control BHK-21 cells; B – Cytopathic effect of CX-01 in BHK-21cells; C – Immunofluorescence results of BHK-21 cells infected with CX-01 after 36 h; D – Negatively stained Akabane virus particles 50–100 nm in diameter. Scale bar - 100 nm
Histopathological images of baby hamster kidney (BHK)-21 cells infected with Akabane virus strain CX01. A – Control BHK-21 cells; B – Cytopathic effect of CX-01 in BHK-21cells; C – Immunofluorescence results of BHK-21 cells infected with CX-01 after 36 h; D – Negatively stained Akabane virus particles 50–100 nm in diameter. Scale bar - 100 nm

Fig. 3

Recombination analysis of the CX-01 strain using a 200-bpsliding window and a 20-bp step. The y-axis indicates the percentage similarity between the query sequence and the reference sequences. Comparison of genome scale similarity of CX-01 (query) with DHL10M110 (green), GXLCH01(pink), Iriki (black), AKAV-32/SKR/2010 (blue) and NM/BS/1 (grey)
Recombination analysis of the CX-01 strain using a 200-bpsliding window and a 20-bp step. The y-axis indicates the percentage similarity between the query sequence and the reference sequences. Comparison of genome scale similarity of CX-01 (query) with DHL10M110 (green), GXLCH01(pink), Iriki (black), AKAV-32/SKR/2010 (blue) and NM/BS/1 (grey)

Fig. 4

Histopathological characteristics in the central nervous tissues of mice with AKAV CX-01 strain. A – brain of a 7-day-old mouse inoculated intraperitoneally (IP) with the CX-01 virus. Neuronal degeneration, necrosis (red arrow) and cavities are visible in the brain stem tissue (black arrow); B–brain of a 7-day-old mouse inoculated intracerebrally (IC) with the CX-01 virus. Enlarged vascular endothelial cells and perivascular infiltration of mononuclear cells (yellow arrow), gaps in the neuron cells (green arrow) and neuronal degeneration and necrosis are visible (red arrow); C – brain of a 7-day-old mouse inoculated IP with the CX-01 virus. The cortex, thalamus and hypothalamus on one side of the tissue have extensive necrosis, and fragmented nuclei are visible (black arrows); D – brain of a 7-day-old mouse inoculated IC with the CX-01 virus. Hippocampal pyramidal cells are regularly arranged, with clear demarcation, and round nuclei with white blood cells in the vascular cavity (yellow arrow). Haematoxylin and eosin staining. Scale bar– 50 μm
Histopathological characteristics in the central nervous tissues of mice with AKAV CX-01 strain. A – brain of a 7-day-old mouse inoculated intraperitoneally (IP) with the CX-01 virus. Neuronal degeneration, necrosis (red arrow) and cavities are visible in the brain stem tissue (black arrow); B–brain of a 7-day-old mouse inoculated intracerebrally (IC) with the CX-01 virus. Enlarged vascular endothelial cells and perivascular infiltration of mononuclear cells (yellow arrow), gaps in the neuron cells (green arrow) and neuronal degeneration and necrosis are visible (red arrow); C – brain of a 7-day-old mouse inoculated IP with the CX-01 virus. The cortex, thalamus and hypothalamus on one side of the tissue have extensive necrosis, and fragmented nuclei are visible (black arrows); D – brain of a 7-day-old mouse inoculated IC with the CX-01 virus. Hippocampal pyramidal cells are regularly arranged, with clear demarcation, and round nuclei with white blood cells in the vascular cavity (yellow arrow). Haematoxylin and eosin staining. Scale bar– 50 μm

Fig. 5

Immunohistochemical characteristics in the central nervous tissues of mice with AKAV CX01 strain. A– brain stem of a mouse inoculated intraperitoneally (IP). Cells detected as antigen positive were observed as dark brown (red arrow); B– brain of a mouse inoculated intracerebrally (IC). Viral antigen is present mainly in neurons of the hippocampus, of which some cells were detected as antigen positive (red arrow); C – brain of a mouse inoculated IP. The hippocampal pyramidal cells were virus antigen–positive (red arrow); D– brain of a mouse inoculated IC. The hippocampal pyramidal cells were virus antigen positive (red arrow). Haematoxylin and eosin staining. Scale bar– 50 μm
Immunohistochemical characteristics in the central nervous tissues of mice with AKAV CX01 strain. A– brain stem of a mouse inoculated intraperitoneally (IP). Cells detected as antigen positive were observed as dark brown (red arrow); B– brain of a mouse inoculated intracerebrally (IC). Viral antigen is present mainly in neurons of the hippocampus, of which some cells were detected as antigen positive (red arrow); C – brain of a mouse inoculated IP. The hippocampal pyramidal cells were virus antigen–positive (red arrow); D– brain of a mouse inoculated IC. The hippocampal pyramidal cells were virus antigen positive (red arrow). Haematoxylin and eosin staining. Scale bar– 50 μm

Comparison of the three segments S, M and L (ORF) and the coding region of the M segment among AKAVs

Genotype Strain Geographic origin and host Pairwise % identity (nt/aa)
S M M L
Gn Gc NSm
Genogroup Ia DHL10M110 ChinaAnopheles vagus 94.7/99.5 91.7/95.6 92.7/80.7 91.3/78.4 90.5/75.7 97.5/99.4
NM/BS/1 ChinaBovine 98.1/99.1 91.8/96.2 92.6/80.7 91.5/78.0 91.9/79.6 -
GXLCH01 ChinaRhizomys pruinosus 97.6/99.6 96.6/97.9 96.8/91.4 96.4/91.1 96.7/91.7 94.5/98.4
GXLCH70N ChinaRhizomys pruinosus 97.7/99.6 96.8/97.9 96.4/90.7 97.2/93.2 95.4/89.0 94.6/98.7
HN10174 ChinaCulex quinquefasciatus - 91.7/96.3 92.0/78.9 91.5/78.0 91.9/79.6 95.1/98.8
KM-1/Br/06 JapanBovine 98.4/100 97.3/97.9 97.4/93.6 97.2/93.5 97.1/92.3 96.2/98.9
AKAV-32/SKR/2010 KoreaBovine 94.9/98.7 97.7/98.4 98.1/95.4 97.7/94.3 97.2/92.8 -
IRIKI JapanBovine 95.0/98.7 94.7/97.0 94.9/81.6 94.5/86.0 93.4/82.9 -
Genogroup Ib FO-90-3 JapanCulicoides spp. 95.3/98.3 91.7/95.6 91.0/71.0 91.8/79.6 92.3/81.2 -
Genogroup II OBE-1 JapanBovine 95.3/98.7 87.5/93.8 89.3/66.8 86.4/66.7 89.4/71.8 91.8/97.6
Genogroup III B8935 AustraliaBovine 92.7/97.4 84.4/91.9 85.7/57.6 84.1/63.2 83.9/58.6 96.4/95.8
Genogroup IV MP496 KenyaAnopheles funestus 83.5/90.6 70.3/74.4 75.2/- 69.9/38.3 65.9/30.4 -

The primers used for the amplification of the small (S), medium (M) and large (L) segments of the Akabane virus genome

Gene Primer Sequence (5´–3´) Position Product size (bp)
S AKVS1 CTCCACTATTAACTACGCAT 9–26 804
AKVS2 GGTGTGCACCACATAGACAT 793–812
M AKVM1 AGTAGTGAACTACCACAACAAAATG 1–25 4,308
AKVM2 AGTAGTGTTCTACCACAACAAATAATTAT 4,280–4,308
L AKVL1 AGTAGTGTACCCCTAAATACAACATACA 1–28 4,151
AKVL2 GTCAGCTTGCTTAAATCCC 4,133–4,151
AKVL3 GTGATTGTGCATTCCTTGG 3,764–3,782 3,106
AKVL4 AGTAGTGTGCCCCTAAATGCAATAATAT 6,842–6,869
eISSN:
2450-8608
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine