<abstract xmlns="http://www.w3.org/1999/xhtml">
<sec id="j_jvetres-2021-0051_s_005">
<h3>Introduction</h3>
<p>Ozone is not harmful itself; however, it directly oxidises biomolecules and produces radical-dependent cytotoxicity. Exposure to ozone is by inhalation and therefore the lungs develop the main anti-inflammatory response, while ozone has an indirect impact on the other organs. This study investigated the local and systemic effects of the ozone-associated inflammatory response.</p>
</sec>
<sec id="j_jvetres-2021-0051_s_006">
<h3>Material and Methods</h3>
<p>Three groups each of 5 Wistar Han rats aged 6 months were exposed for 2h to airborne ozone at 0.5 ppm and a fourth identical group were unexposed controls. Sacrifice was at 3h after exposure for control rats and one experimental group and at 24 h and 48 h for the others. Lung and liver samples were evaluated for changes in expression of transforming growth factor beta 1, anti-inflammatory interleukin 10, pro-inflammatory tumour necrosis factor alpha and interleukin 1 beta and two nuclear factor kappa-light-chain-enhancer of B cells subunit genes. Total RNA was isolated from the samples in spin columns and cDNA was synthesised in an RT-PCR. Expression levels were compared to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and analysed statistically.</p></sec>
<sec id="j_jvetres-2021-0051_s_007">
<h3>Results</h3>
<p>All variables changed non-linearly over time comparing experimental groups to the control. Conspicuous expression changes in the subunit genes and cytokines were observed in both evaluated organs.</p></sec>
<sec id="j_jvetres-2021-0051_s_008">
<h3>Conclusion</h3>
<p>Locally and systemically, inflammation responses to ozone inhalation include regulation of certain genes’ expression. The mechanisms are unalike in lungs and liver but ozone exerts a similar effect in both organs. A broader range of variables influential on ozone response should be studied in the future.</p></sec>
</abstract>

Introduction
Ozone is not harmful itself; however, it directly oxidises biomolecules and produces radical-dependent cytotoxicity. Exposure to ozone is by inhalation and therefore the lungs develop the main anti-inflammatory response, while ozone has an indirect impact on the other organs. This study investigated the local and systemic effects of the ozone-associated inflammatory response.


Material and Methods
Three groups each of 5 Wistar Han rats aged 6 months were exposed for 2h to airborne ozone at 0.5 ppm and a fourth identical group were unexposed controls. Sacrifice was at 3h after exposure for control rats and one experimental group and at 24 h and 48 h for the others. Lung and liver samples were evaluated for changes in expression of transforming growth factor beta 1, anti-inflammatory interleukin 10, pro-inflammatory tumour necrosis factor alpha and interleukin 1 beta and two nuclear factor kappa-light-chain-enhancer of B cells subunit genes. Total RNA was isolated from the samples in spin columns and cDNA was synthesised in an RT-PCR. Expression levels were compared to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and analysed statistically.

Results
All variables changed non-linearly over time comparing experimental groups to the control. Conspicuous expression changes in the subunit genes and cytokines were observed in both evaluated organs.

Conclusion
Locally and systemically, inflammation responses to ozone inhalation include regulation of certain genes’ expression. The mechanisms are unalike in lungs and liver but ozone exerts a similar effect in both organs. A broader range of variables influential on ozone response should be studied in the future.

Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats

Journal of Veterinary Research

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Introduction
Ozone is not harmful itself; however, it directly oxidises biomolecules and produces radical-dependent cytotoxicity. Exposure to ozone is by...

Gene name	GenBank number	5ʹ→3ʹ		Exon junction	Product length (bp)
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)	NM_017008.4	Forward	CATGGCCTTCCGTGTTCCTA		74
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)	NM_017008.4
		Reverse	ACTTGGCAGGTTTCTCCAGG	825/826

Nuclear factor of kappa-light-chain- enhancer in B - cells 1 (NF-κB1)	NM_001276711.1	Forward	GCCAACTGGCAGGTATTTGAC	2694/2695	117
	NM_001276711.1
		Reverse	TTGCAGCCTCGTGTCTTCTG

Nuclear factor of kappa-light-chain- enhancer in B - cells 2, p49/p100 (NF-κB2)	NM_001008349.1	Forward	TGGTACAGAGCGGTAAGAGTG	2326/2327	134
	NM_001008349.1
		Reverse	TCTGTCTCAGCCAGGCTACC

Interleukin 10 (IL-10)	NM_012854.2	Forward	TGCGACGCTGTCATCGATTT	379/380	129
Interleukin 10 (IL-10)	NM_012854.2
		Reverse	TGGCCTTGTAGACACCTTTGT

Tumour necrosis factor alpha (TNF-α)	NM_012675.3	Forward	ATGGGCTCCCTCTCATCAGT		106
Tumour necrosis factor alpha (TNF-α)	NM_012675.3
		Reverse	GCTTGGTGGTTTGCTACGAC	433/434

Interleukin 1beta (IL-1β)	NM_031512.2	Forward	CCTATGTCTTGCCCGTGGAG		82
Interleukin 1beta (IL-1β)	NM_031512.2
		Reverse	AGAGGACGGGCTCTTCTTCAA	354/355

Transforming growth factor, beta 1 (TGF-β1)	NM_021578.2	Forward	CTGCTGACCCCCACTGATAC		94
Transforming growth factor, beta 1 (TGF-β1)	NM_021578.2
		Reverse	AGCCCTGTATTCCGTCTCCT	779/780

Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats

Article Category: Review article

Published Online: Oct 06, 2021

Page range: 513 - 517

Received: Apr 27, 2020

Accepted: Sep 09, 2021

DOI: https://doi.org/10.2478/jvetres-2021-0051

Keywords
ozone, free radicals, inflammatory response, respiratory tract inflammation, rat

© 2021 M. Chmielewska-Krzesińska, K. Wąsowicz, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Fig. 2

Genes and sequences of primers used in the experiment

Local and systemic influence of toxic levels of airborne ozone on the inflammatory response in rats

Article Category: Review article

Published Online: Oct 06, 2021

Page range: 513 - 517

Received: Apr 27, 2020

Accepted: Sep 09, 2021

DOI: https://doi.org/10.2478/jvetres-2021-0051

Keywordsozone, free radicals, inflammatory response, respiratory tract inflammation, rat

© 2021 M. Chmielewska-Krzesińska, K. Wąsowicz, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Fig. 2

Genes and sequences of primers used in the experiment

Keywords
ozone, free radicals, inflammatory response, respiratory tract inflammation, rat