<abstract xmlns="http://www.w3.org/1999/xhtml">The efficacy of the antimicrobial Fumagilin-B® against nosemosis was evaluated in both spring and autumn feeding treatments following label directions in seventy-two honey bee (<italic>Apis mellifera</italic>) colonies across three apiaries in Nova Scotia, Canada. The seasonal trend of <italic>Nosema</italic> spp. spore loads was also tracked in these same colonies throughout a thirteen-month period (February 2018 – March 2019). We found the spring Fumagilin-B® treatment to be effective at significantly suppressing <italic>Nosema</italic> spp. spore levels below the recommended treatment threshold. There was no effect of Fumagilin-B® treatment in the autumn based on low spore levels at this time. We detected a drastic increase in <italic>Nosema</italic> spp. spore loads as May progressed but a decline in spores in summer (June–September). By October, there was another increase in spore levels, but this increase did not exceed the economic treatment threshold. Across seventeen collection periods in both control and Fumagilin-B® colonies, 74% (25) of samples tested positive for <italic>Nosema ceranae</italic>, while 26% (9) contained no <italic>Nosema</italic> spp. spores. No <italic>Nosema apis</italic> spores were detected during this trial. Our results indicate that Fumagilin-B® is an effective management practice in the spring, but colonies should still be monitored in the autumn. Our data also support that the <italic>Nosema</italic> species profile is shifting to be exclusively <italic>N. ceranae</italic> and the treatment threshold for Fumagilin-B® may need to be updated to reflect this, as the threshold was originally developed for <italic>N. apis</italic>.</abstract>

The efficacy of the antimicrobial Fumagilin-B® against nosemosis was evaluated in both spring and autumn feeding treatments following label directions in seventy-two honey bee (Apis mellifera) colonies across three apiaries in Nova Scotia, Canada. The seasonal trend of Nosema spp. spore loads was also tracked in these same colonies throughout a thirteen-month period (February 2018 – March 2019). We found the spring Fumagilin-B® treatment to be effective at significantly suppressing Nosema spp. spore levels below the recommended treatment threshold. There was no effect of Fumagilin-B® treatment in the autumn based on low spore levels at this time. We detected a drastic increase in Nosema spp. spore loads as May progressed but a decline in spores in summer (June–September). By October, there was another increase in spore levels, but this increase did not exceed the economic treatment threshold. Across seventeen collection periods in both control and Fumagilin-B® colonies, 74% (25) of samples tested positive for Nosema ceranae, while 26% (9) contained no Nosema spp. spores. No Nosema apis spores were detected during this trial. Our results indicate that Fumagilin-B® is an effective management practice in the spring, but colonies should still be monitored in the autumn. Our data also support that the Nosema species profile is shifting to be exclusively N. ceranae and the treatment threshold for Fumagilin-B® may need to be updated to reflect this, as the threshold was originally developed for N. apis.

Evaluating Efficacy of Fumagilin-B® Against Nosemosis and Tracking Seasonal Trends of <italic>Nosema</italic> spp. in Nova Scotia Honey Bee Colonies

Journal of Apicultural Science

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Evaluating Efficacy of Fumagilin-B Against Nosemosis and Tracking Seasonal Trends of  spp. in Nova Scotia Honey Bee Colonies

The efficacy of the antimicrobial Fumagilin-B® against nosemosis was evaluated in both spring and autumn feeding treatments following label directions in...

Date	Description
28 February 2018	First sample collection
27 March 2018	Regular monthly sample collection
23 April 2018	Pre spring treatment
24 & 25 April 2018	Spring treatment and feeding (no samples collected)
27 April 2018	2–3 days post spring treatment
01 May 2018	5–6 days post spring treatment
07 May 2018	12–13 days post spring treatment
10 May 2018	15–16 days post spring treatment
29 May 2018	34–35 days post spring treatment/Regular monthly sample collection
26 June 2018	Regular monthly sample collection
26 July 2018	Regular monthly sample collection
29 August 2018	Regular monthly sample collection
03 October 2018	Pre fall treatment
05 & 06 October 2018	Fall treatment and feeding (no samples collected)
10 October 2018	4–5 days post fall treatment
16 October 2018	10–11 days post fall treatment
19 October 2018	13–14 days post fall treatment
29 October 2018	23–24 days post fall treatment
14 March 2019	Final sample collection

Target	Primer	Sequence (5′–3′)	Amplicon size (bp)
RPS5	RPS5-F	AATTATTTGGTCGCTGGAATTG	105
RPS5	RPS5-R	TAACGTCCAGCAGAATGTGGTA	105
RNA polymerase	Ncpol-F	TGG GTT CCC TAA ACC TGG TGG TTT	662
	Ncpol-R	TCA CAT GAC CTG GTG CTC CTT CT	297
	Napol-F	AGC AAG AGA CGT TTC TGG TAC CTC A
	Napol-R	CCT TCA CGA CCA CCC ATG GCA

Evaluating Efficacy of Fumagilin-B^® Against Nosemosis and Tracking Seasonal Trends of Nosema spp. in Nova Scotia Honey Bee Colonies

Article Category: Original Article

Published Online: Nov 18, 2020

Page range: 277 - 286

Received: Jan 28, 2020

Accepted: Oct 03, 2020

DOI: https://doi.org/10.2478/jas-2020-0025

Keywords
Fumagilin-B, honey bees, spp

© 2020 Robyn McCallum et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Honey bee sampling schedule and description from February 2018 to March 2019 in Nova Scotia colonies

List of primers used to identify Nosema species

Evaluating Efficacy of Fumagilin-B® Against Nosemosis and Tracking Seasonal Trends of Nosema spp. in Nova Scotia Honey Bee Colonies

Article Category: Original Article

Published Online: Nov 18, 2020

Page range: 277 - 286

Received: Jan 28, 2020

Accepted: Oct 03, 2020

DOI: https://doi.org/10.2478/jas-2020-0025

KeywordsFumagilin-B, honey bees, spp

© 2020 Robyn McCallum et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Honey bee sampling schedule and description from February 2018 to March 2019 in Nova Scotia colonies

List of primers used to identify Nosema species

Evaluating Efficacy of Fumagilin-B^® Against Nosemosis and Tracking Seasonal Trends of Nosema spp. in Nova Scotia Honey Bee Colonies

Keywords
Fumagilin-B, honey bees, spp