The
Eighteen haplotypes of
In Cuba, the first report of the
An initial morphometric description of
Adult
Map of sampled locations. PR: Pinar del Rio, LH: La Habana, MY: Mayabeque, MT: Matanzas, LT: Las Tunas, HO: Holguín, SC: Santiago de Cuba, GT: Guantánamo. Black triangles represent localization on the sampled apiaries.
The total DNA was individually extracted for each mite through the conventional method described by Miller, Dykes, and Polesky (1988) with modifications. Subsequently, the extracted DNA was purified using WizardTM Minipreps DNA Purification System (Promega) to clean impurities and salts that inhibit the PCR reaction. Haplotype determination was carried out by two alternative PCR-RFLP methods on cytochrome C oxidase 1 (COI) gene of the mitochondrial genome. For both methods, amplifications were carried out using GoTaq® Hot Start Green Master Mix (Promega). The reaction mix contained 7.5 μL of GoTaq® Hot Start Green Master Mix 2X, 1.5 μL of each primer (10 μM) and 4.5 μL of DNA template for a final volume of 15 μL.
The first method amplifies a region of 570 bp (Navajas et al., 2002) using the primers COXF and COXRa. The amplicons were digested with SacI which generate two restriction fragments for J haplotype (230 and 340 bp) but produce no cut in K haplotype because of the lack of restriction site (Anderson & Trueman, 2000). The amplification conditions used were initial denaturing at 94°C for 5 min, thirty-five cycles of denaturation at 94°C for 1 min, annealing at 52°C for 1 min and elongation at 72°C for 1 min and ends with a final elongation of 72°C for 10 min. Restriction assay was achieved using SacI (Thermo Scientific) mixing 10 μL of each sample with 16 μL of Nuclease Free Water (Promega), 2 μL of 10X Buffer for SacI and 2 μL on SacI. Samples were incubated at 37°C for 2h. Due to the difficulty of having a positive control for the J haplotype, we decided to use an alternative PCR-RFLP method (Mendoza unpublished) with internal control of digestion, in which both haplotypes had restriction sites. This new method amplifies a 470 bp fragment between positions 276 and 736 of COI using primers (VD-CO206F: 5′ACCAGATATAGCTTTTCCACG3′, VD-CO650R: 5′AAATATAAACTTCTGGGT-GTCC3′). The Amplified region digested with EcoNI generates three restriction fragments for J haplotype (68, 129, and 273 bp) and two restriction fragments for K haplotype (129 and 341 bp). The amplification conditions used were initial denaturing at 94°C for 5 min, thirty cycles of denaturation at 94°C for 45 s, annealing at 47°C for 15 min and elongation at 72°C for 1 min, and a final elongation step at 72°C for 5 min. In this case, the restriction was carried out mixing 8 μL amplification products, 1μL of NE Buffer 4 (New England Biolabs) and 1μL of EcoNI (New England Biolabs). Digested products were electrophoresed in 2% agarose gel for approximately 30 min at 120V and then visualized through ethidium bromide staining in a UV transilluminator.
STRs loci VD016, VD112, and VD114 described by Solignac et al. (2003) were amplified and genotyped. These loci were selected because they were described as polymorphic and their allele variation associated with the geographical origin of Varroa strains (J or K haplotypes) (Solignac et al., 2005). Multiplex amplification of the three STRs was carried out using GoTaq® Hot Start Green Master Mix from Promega. Reaction mix contained 10 μL of GoTaq® Hot Start Green Master Mix 2X, 0.35 μL of each primer (40 μM), 7.2 μL of DNA template for a final volume of 20 μL. PCR conditions were initial denaturing at 94°C for 3 min, thirty-five cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and elongation at 72°C for 30 s and a final elongation at 72°C for 10 min.
The PCR products were electrophoresed in 8-mm-thick denaturing polyacrylamide gels (acrylamide:bisacrylamide 19:1 and 7% urea) for approximately 4h at 1,000–1,200V and visualized through silver staining modified from Sanguinetti, Dias & Simpson (1994). Individual genotypes were independently determined by two observers and absolute allele size estimated through comparing with a 10 bp standard size (GIBCO BRL).
STR data was analyzed for the presence of null alleles, large allele dropout and scoring errors using MICROCHECKER v.2.2.3 (Van Oosterhout et al., 2004). We assessed departure from Hardy-Weinberg equilibrium (HWE), linkage disequilibrium (LD) and exact tests for genic and genotypic population differentiation for each locus independently and all loci together using GenePop (Raymond & Rousset, 1995), excluding monomorphic locus VD016. Allelic frequencies and heterozygosis were performed in Genalex (Peakall & Smouse, 2006). Exact test overall and pairwise Fst estimates were calculated in Genalex. To evaluate the partitioning of genetic variation within and among individuals and between mite populations we used a one-way analysis of molecular variance (AMOVA) in Genalex.
The COI region of the mite
Restriction profiles of COI region of Varroa destructor mtDNA. Eight provinces of Cuba were sampled and displayed numbered from 1 to 8. 1: PR, 2: LH, 3: MY, 4: MT, 5: LT, 6: HO, 7: SC and 8:GT. The mtDNA was digested with endonucleases SacI and EcoNI. Lane L: 100-bp DNA ladder, Lane A: Undigested amplicons (amplified with COXF and COXRa primers) and Lane B: Undigested amplicons (amplified with VD-CO206F and VD-CO206R).
Microsatellites absolute sizes and frequencies of alleles found in Cuba. He and Ho are expected and observed heterocigocity, respectively
Allele size (bp) | Localities | |||
---|---|---|---|---|
Locus | sequenced * | this study | Mayabeque | La Habana |
142 | 158 | 0.04 | 0.04 | |
160 | 0.00 | 0.08 | ||
168 | 0.88 | 0.58 | ||
178 | 0.08 | 0.29 | ||
0.25 | 0.67 | |||
0.23 | 0.57 | |||
217 | 246 | 0.09 | 0.08 | |
250 | 0.91 | 0.92 | ||
0.00 | 0.00 | |||
0.17 | 0.15 | |||
268 | 316 | 1 | 1 | |
0 | 0 | |||
0 | 0 |
alleles reported by Solignac et al. 2003.
No evidence of null alleles or of linkage disequilibrium was detected between polymorphic loci (p=1), but statistical significant departures from HWE was detected in both loci in all samples and by population (p < 0.05). Exact tests for genic and genotypic population differentiation were neither significant for all loci (P=0.27) nor by loci but almost marginal for VD112 (p=0.08, both genic and genotypic). Furthermore, the overall and pairwise Fst values for locus VD112 indicate a differentiation between La Habana and Mayabeque populations (Fst 0.11). However, AMOVA calculations given by GenAlex show that a higher percentage of variation occurs among individuals (96%) and within individuals (4%), but no variation was detected among populations.
This study presents the first molecular characterization of Cuban
The proposed PCR-RFLP fulfilled our expectations, and we successfully discriminated J/K haplogroups in the absence of Japanese haplogroup control. The presence of K haplotype is not surprising as it is common throughout the world (Anderson & Trueman, 2000; Rosenkranz, Aumeier, & Ziegelmann, 2010). This result is in concordance with previous studies in which the K haplotype was detected in seven samples of Cuban mites (Guerra Jr et al. 2010). This haplotype is described as the most pathogenic. Following the first detection of
However, today varroasis is not a problem in Cuba possibly due to an increased resistance of honeybee populations. For example, a greater expression of Varroa Sensitive Hygiene (VSH) is possibly favored by the natural selection and the intentional breeding of the bees that survived this pathogen without the use of chemical treatments. The program of selection, management, and improvement of Cuban honeybees carried out since 2013 may have contributed to the increased resistance of the populations of Cuban honeybee through the selection and reproduction of the most hygienic honeybees. This program is based on the selection and breeding of colonies with the highest production rates but also infestation rates and hygienic behavior.
More interesting results were obtained from STR loci genotyped in order to find traces of the J haplotype in Cuban mites. The three genotyped loci were selected for this study because they were polymorphic and their allelic variation was associated with the different mitochondrial haplotypes (Solignac et al., 2005). The genotyped loci VD112 and VD114 turned out to be polymorphic while VD016 was monomorphic. The difference in the third locus is not striking and can be explained through drift allele fixation. The absolute size of found alleles differed in 16, 30 and almost 50 bp for VD112, VD114 and VD016 loci, respectively, when compared to the absolute size previously reported for those loci by Solignac et al. (2003). Recently, Dieteman et al. (2019) analyzed
In addition to finding new alleles for VD112, its variation is greater than previously reported for some global studies. Solignac et al. (2005) reported only three alleles for this locus worldwide, but for the two genotyped Cuban populations, La Habana and Mayabeque, we have found four alleles. Similar results were reported by Dietemann et al. (2019) in Thailand, who found four alleles. There is extensive evidence that
In addition, we observed a considerable difference, both at a genic and genotypic level, between the two populations studied, which are located at a distance of around 70 km from each other and with no geographical barriers between them. This variation is not reflected in the differentiation tests, possibly due to the low sample size (N=12 in each population). The heterozygosity of the two populations also differs, which could reflect differences in the population sizes between localities, if we assume that STR used are neutral loci. Under neutrality, the balance between genetic drift and neutral mutation would result in larger populations presenting a greater heterozygosis than those of smaller size. In this case, the differences observed might be a consequence of a lower density of colonies in La Habana, a more anthropized landscape, than in Mayabeque. Additionally, beekeepers in such countryside areas as Mayabeque tend to move colonies following the flowering periods with movements of the colonies beyond the restrictive province borders. The sampled apiary in Mayabeque moves its colonies no more than 10 Km. In contrast, samples in La Habana were collected in the experimental apiary of Centro de Investigaciones Apícolas (CIAPI) where apiaries are not moved around.
In summary, the results show that the current