<abstract xmlns="http://www.w3.org/1999/xhtml">

<p>The present study was conducted in the isolated desert town of Oranjemund in the far south of Namibia. It is an extremely arid region where no livestock husbandry is practiced and only animals adapted to the desert can be found. However, in and around the city, artificial irrigation maintains lush green patches of grass that attract wild animals, in particular oryx antelopes (<italic>Oryx gazella</italic>). In 2015 four oryx antelopes were euthanised due to poor conditions and a post-mortem examination was conducted. Two were found positive for cystic echinococcosis and 16 cysts were collected for molecular analyses. In addition, faecal samples from black-backed jackals (n=5) and domestic dogs (n=9), which were regularly observed to feed on oryx carcasses, were collected and taeniid eggs isolated. Parasite species identification of the cysts and eggs was done by amplifying and sequencing the mitochondrial <italic>nad1</italic> gene. Both oryx antelopes were found infected with <italic>E. ortleppi</italic> and one co-infected with <italic>E. canadensis</italic> G6/7. Both <italic>Echinococcus</italic> species were able to develop fertile cysts in oryx, making oryx antelopes competent hosts for these parasites. Therefore, the analysis of faecal samples was of high interest and although the numbers were quite small, taeniid eggs were found in three out of five faecal samples of jackals and in all nine dog samples. However, species determination was only successful with two jackal and one dog sample. All three were positive for <italic>E. canadensis</italic> G6/7. The absence of <italic>E. ortleppi</italic> may be due to the low number of faecal samples examined. In our small study, we discovered a rather unique lifecycle of <italic>Echinococcus</italic> spp. between jackals and domestic dogs as definitive hosts and oryx antelopes as intermediate hosts. Here, the presence of <italic>E. canadensis</italic> G6/7 is of particular concern, as it is the second most important causative agent of CE in humans.</p>
</abstract>

The present study was conducted in the isolated desert town of Oranjemund in the far south of Namibia. It is an extremely arid region where no livestock husbandry is practiced and only animals adapted to the desert can be found. However, in and around the city, artificial irrigation maintains lush green patches of grass that attract wild animals, in particular oryx antelopes (Oryx gazella). In 2015 four oryx antelopes were euthanised due to poor conditions and a post-mortem examination was conducted. Two were found positive for cystic echinococcosis and 16 cysts were collected for molecular analyses. In addition, faecal samples from black-backed jackals (n=5) and domestic dogs (n=9), which were regularly observed to feed on oryx carcasses, were collected and taeniid eggs isolated. Parasite species identification of the cysts and eggs was done by amplifying and sequencing the mitochondrial nad1 gene. Both oryx antelopes were found infected with E. ortleppi and one co-infected with E. canadensis G6/7. Both Echinococcus species were able to develop fertile cysts in oryx, making oryx antelopes competent hosts for these parasites. Therefore, the analysis of faecal samples was of high interest and although the numbers were quite small, taeniid eggs were found in three out of five faecal samples of jackals and in all nine dog samples. However, species determination was only successful with two jackal and one dog sample. All three were positive for E. canadensis G6/7. The absence of E. ortleppi may be due to the low number of faecal samples examined. In our small study, we discovered a rather unique lifecycle of Echinococcus spp. between jackals and domestic dogs as definitive hosts and oryx antelopes as intermediate hosts. Here, the presence of E. canadensis G6/7 is of particular concern, as it is the second most important causative agent of CE in humans.

When wildlife comes to town: interaction of sylvatic and domestic host animals in transmission of <italic>Echinococcus</italic> spp. in Namibia

Ministry of Environment, Forestry and Tourism

University of Zurich, Institute of Parasitology

Helminthologia

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

When wildlife comes to town: interaction of sylvatic and domestic host animals in transmission of  spp. in Namibia

The present study was conducted in the isolated desert town of Oranjemund in the far south of Namibia. It is an extremely arid region where no livestock...

	n cysts examined	Echinococcus species
Oryx A	11 (lungs, fertile)	EC (n=10), EO (n=1)
Oryx A	1 (liver, sterile)	na (n=1)
Oryx B	4 (liver, sterile)	EO (n=2), na (n=2)

Target	Primers for first PCR (5′-3′)	Primers for nested PCR (5′-3′)
Complete nad1 gene	F: TGGAACTCAGTTTGAGCTTTACTA	F: TATTAAAAATATTGAGTTTGCGTC
Complete nad1 gene	R: ATATCAAAGTAACCTGCTATGCAG	R: TCTTGAAGTTAACAGCATCACGAT
~190 bp fragment of nad1	F: TGTTTTTGAGATCAGTTCGGTGTG	F: CAGTTCGGTGTGCTTTTGGGTCTG
~190 bp fragment of nad1	R: CATAATCAAACGGAGTACGATTAG	R: GAGTACGATTAGTCTCACACAGCA

Host species	Number of isolated taeniid eggs	Number of successful amplified and sequenced eggs	species identified (number of eggs)
Dog A	2	-	-
Dog B	10	4	E. canadensis G6/7 (4)
Dog C	7	-	-
Dog D	10	-	-
Dog E	2	-	-
Dog F	3	-	-
Dog G	2	-	-
Dog H	7	-	-
Dog I	2	-	-
Jackal A	-	-	-
Jackal B	30	6	E. canadensis G6/7 (6)
Jackal C	-	-	-
Jackal D	19	2	E. canadensis G6/7 (2)
Jackal E	10	-	-

When wildlife comes to town: interaction of sylvatic and domestic host animals in transmission of Echinococcus spp. in Namibia

Published Online: Sep 22, 2023

Page range: 117 - 124

Received: Mar 18, 2023

Accepted: May 29, 2023

DOI: https://doi.org/10.2478/helm-2023-0012

Keywords
wildlife, Namibia, urban cycle, oryx, black-backed jackal

© 2023 O. Aschenborn et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Cysts identified from oryx antelopes (EC = E. canadensis G6/7, EO = E. ortleppi, na = not amplifiable).

Primer pairs used for PCRs (Hüttner et al., 2008).

Number of eggs and Echinococcus species identified from faecal samples.

When wildlife comes to town: interaction of sylvatic and domestic host animals in transmission of Echinococcus spp. in Namibia

Published Online: Sep 22, 2023

Page range: 117 - 124

Received: Mar 18, 2023

Accepted: May 29, 2023

DOI: https://doi.org/10.2478/helm-2023-0012

Keywordswildlife, Namibia, urban cycle, oryx, black-backed jackal

© 2023 O. Aschenborn et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Cysts identified from oryx antelopes (EC = E. canadensis G6/7, EO = E. ortleppi, na = not amplifiable).

Primer pairs used for PCRs (Hüttner et al., 2008).

Number of eggs and Echinococcus species identified from faecal samples.

Keywords
wildlife, Namibia, urban cycle, oryx, black-backed jackal