Open Access

Molecular characterisation of cornelian cherry (Cornus mas L.) genotypes

Azra Skender
Azra Skender
, 
Gordana Ðurić
Gordana Ðurić
, 
Amine Assouguem
Amine Assouguem
, 
Sezai Ercisli
Sezai Ercisli
, 
Gulce Ilhan
Gulce Ilhan
, 
Rachid Lahlali
Rachid Lahlali
, 
Riaz Ullah
Riaz Ullah
, 
Zafar Iqbal
Zafar Iqbal
 and 
Ahmed Bari
Ahmed Bari
   | Jul 04, 2024
Folia Horticulturae's Cover Image
About this article
Previous Article
Next Article
Cite
Article Category: Original Article
Published Online: Jul 04, 2024
Page range: -
Received: Apr 03, 2024
Accepted: May 28, 2024
DOI: https://doi.org/10.2478/fhort-2024-0013
Keywords
© 2024 Azra Skender et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1.

Results of PCoA analysis of individual cornelian cherry genotypes. PCoA, Principal coordinate analysis.
Results of PCoA analysis of individual cornelian cherry genotypes. PCoA, Principal coordinate analysis.

Figure 2.

NJ dendrogram of the cornelian cherry genotypes based on the results of the interindividual genetic distance analysis. The codes of the genotypes are: D1,2,3,…(Drvar1,2,3,…); M1,2,3,…(Mostar1,2,3,…); Z1,2,3,… (Zenica1,2,3,…). NJ, Neighbour-Joining.
NJ dendrogram of the cornelian cherry genotypes based on the results of the interindividual genetic distance analysis. The codes of the genotypes are: D1,2,3,…(Drvar1,2,3,…); M1,2,3,…(Mostar1,2,3,…); Z1,2,3,… (Zenica1,2,3,…). NJ, Neighbour-Joining.

PCR protocol temperature regime for two separate PCR reactions (mix 1 and mix 2).

Protocol
Temperature (°C) Duration (min:s) Number of cycles
Enzyme activation 95 5:00
Denaturation 94 0:40
Annealing 52 0:40 35
Elongation 72 0:30
Final elongation 72 4:00

Results of F statistical analysis.

Locus FIS FIT FST
CM007 -0.111 -0.086 0.022
CM008 0.154 0.201 0.056
CM010 0.161 0.191 0.036
CM026 0.146 0.189 0.051
CM031 0.059 0.083 0.025
CM037 -0.077 -0.052 0.023
CM039 -0.029 0.012 0.040
CM043 0.150 0.224 0.086
Average 0.057 0.095 0.042

Proportion of components used in PCR reaction mix 1 and mix 2.

Mix 1 Mix 2
Components Reaction concentration Components Reaction concentration
CM007 0.1 μM CM031 0.2 μM
CM008 0.2 μM CM037 0.2 μM
CM010 0.1 μM CM039 0.2 μM
CM026 0.1 μM CM043 0.2 μM
dNTP 0.2 mM dNTP 0.2 mM
PCR buffer 1× PCR buffer 1×
MgCl2 2.5 mM MgCl2 2.5 mM
Taq pol. 0.2 U · μL-1 Taq pol. 0.2 U · μL-1
DNA 10 ng DNA 10 ng
ddH2O to 15 μL ddH2O to 15 μL

Deviation of eight examined SSR loci from HW equilibrium in the total set samples.

Population Locus SS χ2 p-value Significance
Drvar CM007 45 63.942 0.033 *
Drvar CM008 36 71.652 0.000 ***
Drvar CM010 36 76.893 0.000 ***
Drvar CM026 21 14.129 0.864 ns
Drvar CM031 55 61.856 0.245 ns
Drvar CM037 36 27.500 0.845 ns
Drvar CM039 28 58.890 0.001 ***
Drvar CM043 15 14.860 0.462 ns
Mostar CM007 78 90.510 0.157 ns
Mostar CM008 55 75.422 0.035 *
Mostar CM010 91 104.822 0.153 ns
Mostar CM026 21 22.016 0.399 ns
Mostar CM031 28 28.657 0.430 ns
Mostar CM037 55 56.788 0.408 ns
Mostar CM039 28 69.540 0.000 ***
Mostar CM043 21 18.345 0.627 ns
Zenica CM007 45 48.200 0.345 ns
Zenica CM008 28 10.674 0.999 ns
Zenica CM010 45 55.142 0.143 ns
Zenica CM026 10 15.985 0.100 ns
Zenica CM031 55 41.147 0.917 ns
Zenica CM037 21 15.396 0.803 ns
Zenica CM039 15 78.395 0.000 ***
Zenica CM043 6 5.235 0.514 ns

Parameters of heterozygosity.

Populations Locus Na Ne R P (R) Ho He F
Drvar CM007 10.000 7.339 0.735 0.1979 0.950 0.864 -0.100
CM008 9.000 5.517 0.614 0.1311 0.550 0.819 0.328
CM010 9.000 6.723 0.746 0.2046 0.550 0.851 0.354
CM026 7.000 3.846 0.549 0.1 0.650 0.740 0.122
CM031 11.000 4.938 0.45 0.059 0.600 0.798 0.248
CM037 9.000 4.348 0.483 0.0717 0.800 0.770 -0.039
CM039 8.000 5.298 0.661 0.1556 0.850 0.811 -0.048
CM043 6.000 4.145 0.692 0.1727 0.700 0.759 0.077
Mostar CM007 13.000 7.339 0.566 0.1078 0.950 0.864 -0.100
CM008 11.000 8.000 0.727 0.1931 0.750 0.875 0.143
CM010 14.000 9.877 0.707 0.1813 0.850 0.899 0.054
CM026 7.000 4.571 0.652 0.1508 0.750 0.781 0.040
CM031 8.000 5.063 0.634 0.1413 0.800 0.803 0.003
CM037 11.000 5.594 0.508 0.082 0.850 0.821 -0.035
CM039 8.000 5.298 0.661 0.1556 0.700 0.811 0.137
CM043 7.000 4.651 0.664 0.1572 0.650 0.785 0.172
Zenica CM007 10.000 8.602 0.862 0.2857 1.000 0.884 -0.132
CM008 8.000 3.687 0.461 0.0631 0.750 0.729 -0.029
CM010 10.000 7.843 0.787 0.2309 0.800 0.873 0.083
CM026 5.000 4.188 0.837 0.2663 0.550 0.761 0.278
CM031 11.000 4.790 0.435 0.0535 0.850 0.791 -0.074
CM037 7.000 4.469 0.638 0.1434 0.900 0.776 -0.159
CM039 6.000 3.448 0.575 0.112 0.850 0.710 -0.197
CM043 4.000 2.067 0.516 0.0854 0.400 0.516 0.225
Average (Drvar) 8.625 5.269 0.584 0.1163 0.706 0.801 0.118
Average (Mostar) 9.875 6.299 0.595 0.1217 0.788 0.830 0.052
Average (Zenica) 7.625 4.887 0.535 0.0937 0.763 0.755 -0.001
Average (Total) 8.708 5.485 0.561 0.1055 0.752 0.795 0.056

SSR markers and characteristics.

SSR markers Primer sequence (5′ → 3′) A repetitive pattern
CM007

R:tccagggaatgttcggtagattag

L:gtttaggtgtgagtgcagatgg

 (GT)24
CM008

L:tcgttaatgtgaaattggaacg

R:caccgtacacgcaaagtcc

 (GT)11
CM010

L:gctagcagaagcacagttagcc

R:tccaacatgtaaaacctagatgc

 (CA)12
CM026

L:gaattcatgtaatgttgttgtctgc

R:cctgcatataattcaggtaaagagc

 (CA)14
CM031

L:taccctctcttgctctttgtcc

R:aaacaatcaaacccaaacaacc

 (AG)26(TG)13
CM037

L:aacacagagaaacacgtgcaa

R:tggagatctttgaagaacagga

 (TG)20
CM039

L:gggtattgtaatcaatgtaaaaccaa

R:tcacaccaccagcaatcact

 (GT)18
CM043

L:gtccacacctgttgttcagc

R:ggttgcaatgctttcttgg

 (TG)16(TA)5

AMOVA.

Source df SS MS Estimated Var. %
Among Pops 2 16.650 8.325 0.120 3
Among Indiv. 57 201.300 3.532 0.262 8
Within Indiv. 60 180.500 3.008 3.008 89
Total 119 398.450 3.390 100
eISSN:
2083-5965
Language:
English
Publication timeframe:
2 times per year
Journal Subjects:
Life Sciences, Plant Science, Zoology, Ecology, other
Journal RSS Feed