Open Access

PRKAA2 variation and the clinical characteristics of patients newly diagnosed with type 2 diabetes mellitus in Yogyakarta, Indonesia

,  and   
Aug 20, 2021

Cite
Download Cover

Figure 1

Distribution of PRKAA2 genotype rs2796498, rs9803799, and rs2746342 in patients newly diagnosed with T2DM in Yogyakarta, Indonesia; PRKAA2 (NCBI gene ID: 5563), which encodes protein kinase adenosine monophosphate (AMP)-activated (EC 2.7.11.31) α2 catalytic subunit (AMPKα2); SNP, single nucleotide polymorphism; T2DM, type 2 diabetes mellitus.
Distribution of PRKAA2 genotype rs2796498, rs9803799, and rs2746342 in patients newly diagnosed with T2DM in Yogyakarta, Indonesia; PRKAA2 (NCBI gene ID: 5563), which encodes protein kinase adenosine monophosphate (AMP)-activated (EC 2.7.11.31) α2 catalytic subunit (AMPKα2); SNP, single nucleotide polymorphism; T2DM, type 2 diabetes mellitus.

Clinical characteristics of patients with T2DM patients based on PRKAA2genetic variation

Clinical Characteristic rs2796498 (HWE 0.35)n (%) P rs9803799 (HWE 0.08)n (%) P rs2746342 (HWE 0.36)n (%) P



GG 95 (57.2) AG 64 (38.6) AA 7 (4.2) TT 147 (88.6) GT 17 (10.2) GG 2 (1.2) GG 55 (33.1) GT 86 (51.8) TT 25 (15.1)
Age (years) 53.3 ± 9.5 54.7 ± 10.2 55.7 ± 10.1 0.60 54.1 ± 9.6 53.7 ± 11.3 45.0 ± 2.8 0.42 54.3 ± 9.6 53.7 ± 9.8 54.0 ± 10.2 0.94
BMI (kg/m2) 24.95 ± 3.78 24.83 ± 4.20 27.14 ± 5.40 0.35 25.06 ± 4.03 24.53 ± 4.09 24.50 ± 3.54 0.87 24.60 ± 4.20 25.23 ± 3.69 25.09 ± 4.73 0.66
WC (cm) 87.4 ± 8.7 87.6 ± 10.1 91.0 ± 8.1 0.61 87.4 ± 9.5 90.1 ± 6.5 85.5 ± 3.5 0.49 86.6 ± 9.2 88.2 ± 9.6 88.0 ± 7.9 0.58
SBP (mmHg) 129.5 ± 19.1 131.3 ± 18.5 136.4 ± 15.0 0.57 131.1 ± 18.9 125.7 ± 14.8 124.0 ± 33.9 0.47 127.4 ± 19.7 131.8 ± 18.2 132.9 ± 17.7 0.31
DBP (mmHg) 81.2 ± 8.9 81.1 ± 8.5 80.4 ± 9.6 0.98 81.3 ± 8.2 79.6 ± 12.3 82.0 ± 17.0 0.74 80.0 ± 9.5 81.8 ± 8.6 81.3 ± 7.2 0.51
FPG (mg/dL) 188.8 ± 72.2 191.8 ± 70.8 167.9 ± 68.1 0.70 188.5 ± 70.0 195.5 ± 83.1 196.0 ± 103.2 0.97 186.5 ± 75.2 189.6 ± 68.8 192.7 ± 73.1 0.93
HbA1c (%) 9.65 ± 2.30 9.61 ± 2.35 8.97 ± 2.43 0.76 9.61 ± 2.25 9.66 ± 2.85 8.9 ± 3.40 0.91 9.42 ± 2.30 9.79 ± 2.32 9.39 ± 2.89 0.58
CrSr (mg/dL) 0.81 ± 0.49 1.04 ± 1.13 0.66 ± 0.10 0.48 0.87 ± 0.62 1.13 ± 1.75 0.67 ± 0.13 0.37 0.83 ± 0.52 0.97 ± 1.01 0.80 ± 0.33 0.48
eGFR (mL/min) 94.0 ± 24.7 87.5 ± 30.2 96.6 ± 13.1 0.66 91.5 ± 26.2 90.7 ± 32.6 111.5 ± 3.5 0.57 92.1 ± 24.6 90.9 ± 29.0 93.0 ± 23.7 0.93

Multiple regression logistic analysis adjusted for age, sex, and waist circumference

Genotype OR (95%CI)

FPG HbA1c CrSr eGFR Blood pressure Obesity status
rs2796498
GG 1 (Reference)
AG 1.29 (0.67–2.45) 0.97 (0.50–1.87) 1.79 (0.81–3.96) 2.38 (0.87–6.49) 0.92 (0.46–1.84) 1.31 (0.60–2.87)
AA 1.14 (0.24–5.46) 0.48 (0.09–2.71) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 1.08 (0.22–5.25) 0.89 (0.14–5.49)
Dominant (GG vs. AG+AA) 1.27 (0.68–2.38) 0.91 (0.48–1.72) 1.51 (0.70–3.29) 2.09 (0.77–5.68) 0.94 (0.48–1.83) 1.26 (0.59–2.67)
Recessive (GG+AG vs. AA) 1.03 (0.22–4.81) 0.49 (0.09–2.69) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 1.11 (0.23–5.29) 0.80 (0.13–4.84)
G allele 1 (Reference)
A allele 1.18 (0.70–1.97) 0.87 (0.51–1.47) 1.11 (0.59–2.09) 1.40 (0.65–3.03) 0.97 (0.56–1.68) 1.14 (0.61–2.13)

rs9803799
TT 1 (Reference)
GT 1.17 (0.42–3.24) 0.83 (0.29–2.43) 0.84 (0.22–3.31) 1.82 (0.42–7.92) 0.45 (0.14–1.51) 0.50 (0.15–1.62)
GG 0.99 (0.06–16.53) 0.95 (0.05–16.76) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 3.06 (0.18–52.68) 1.38 (0.07–26.18)
Dominant (TT vs. GT+GG) 1.15 (0.43–3.03) 0.85 (0.31–2.33) 0.71 (0.19–2.68) 1.64 (0.39–6.99) 0.57 (0.19–1.72) 0.57 (0.19–1.72)
Recessive (TT+GT vs. GG) 0.98 (0.06–16.27) 0.97 (0.06–17.00) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 3.24 (0.19–55.53) 1.46 (0.08–27.28)
T allele 1 (Reference)
G allele 1.12 (0.46–2.74) 0.87 (0.34–2.19) 0.62 (0.18–2.20) 1.45 (0.37–5.68) 0.71 (0.26–1.92) 0.65 (0.24–1.78)

rs2746342
GG 1 (Reference)
GT 1.49 (0.75–2.99) 1.63 (0.79–3.34) 0.99 (0.41–2.36) 2.87 (0.85–9.72) 1.39 (0.66–2.95) 1.94 (0.84–4.49)
TT 1.23 (0.47–3.22) 1.35 (0.50–3.66) 1.87 (0.59–5.93) 1.05 (0.16–6.77) 1.60 (0.58–4.43) 1.33 (0.43–4.11)
Dominant (GG vs. GT+TT) 1.43 (0.73–2.78) 1.56 (0.79–3.11) 1.15 (0.50–2.63) 2.39 (0.72–7.87) 1.44 (0.70–2.95) 1.77 (0.80–3.92)
Recessive (GG+GT vs. TT) 0.96 (0.40–2.27) 0.99 (0.41–2.42) 1.89 (0.68–5.25) 0.52 (0.10–2.63) 1.30 (0.53–3.20) 0.89 (0.33–2.44)
G allele 1 (Reference)
T allele 1.16 (0.74–1.81) 1.22 (0.77–1.93) 1.27 (0.73–2.21) 1.23 (0.61–2.48) 1.26 (0.79–2.02) 1.25 (0.74–2.13)

Multiple regression logistic analysis adjusted for age and sex

Genotype OR (95%CI)

FPG HbA1c CrSr eGFR Blood pressure Obesity status
rs2796498
GG 1 (Reference)
AG 1.27 (0.67–2.41) 0.96 (0.50–1.85) 1.79 (0.81–3.94) 2.38 (0.87–6.50) 0.95 (0.48–1.86) 1.20 (0.64–2.28)
AA 1.03 (0.22–4.89) 0.44 (0.08–2.48) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 1.27 (0.26–6.14) 1.49 (0.31–7.07)
Dominant (GG vs. AG+AA) 1.24 (0.67–2.32) 0.89 (0.47–1.69) 1.51 (0.70–3.29) 2.08 (0.77–5.67) 0.98 (0.51–1.88) 1.23 (0.66–2.28)
Recessive (GG+AG vs. AA) 0.93 (0.20–4.34) 0.45 (0.08–2.48) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 1.30 (0.28–6.13) 1.38 (0.30–6.42)
G allele 1 (Reference)
A allele 1.15 (0.69–1.92) 0.85 (0.50–1.44) 1.11 (0.59–2.09) 1.34 (0.65–3.00) 1.02 (0.59–1.74) 1.19 (0.72–1.98)

rs9803799
TT 1 (Reference)
GT 1.08 (0.39–2.98) 0.79 (0.27–2.27) 0.86 (0.22–3.33) 1.67 (0.39–7.14) 0.54 (0.17–1.74) 0.89 (0.32–2.44)
GG 1.06 (0.06–17.61) 1.07 (0.06–17.93) <0.01 (<0.01–NA) <0.01 (0.01–NA) 2.52 (0.15–42.41) 0.96 (0.06–15.95)
Dominant (TT vs. GT+GG) 1.08 (0.41–2.83) 0.81 (0.30–2.21) 0.72 (0.19–2.70) 1.53 (0.37–6.43) 0.65 (0.22–1.91) 0.90 (0.34–2.34)
Recessive (TT+GT vs. GG) 1.05 (0.06–17.44) 1.03 (0.06–18.30) <0.01 (<0.01–NA) <0.01 (0.01–NA) 2.66 (0.16–44.71) 0.97 (0.06–16.11)
T allele 1 (Reference)
G allele 1.07 (0.44–2.61) 0.71 (0.84–2.12) 0.63 (0.18–2.22) 1.38 (0.35–5.39) 0.77 (0.29–2.06) 0.91 (0.37–2.21)

rs2746342
GG 1 (Reference)
GT 1.42 (0.71–2.83) 1.55 (0.76–3.14) 0.99 (0.42–2.37) 2.81 (0.83–9.51) 1.48 (0.71–3.09) 1.89 (0.95–3.76)
TT 1.17 (0.45–3.06) 1.30 (0.48–3.47) 1.88 (0.59–5.95) 1.04 (0.16–6.65) 1.67 (0.61–4.54) 1.39 (0.54–3.60)
Dominant (GG vs. GT+TT) 1.36 (0.71–2.63) 1.49 (0.75–2.93) 1.16 (0.51–2.63) 2.34 (0.71–7.71) 1.52 (0.75–3.07) 1.76 (0.91–3.40)
Recessive (GG+GT vs. TT) 0.95 (0.40–2.23) 0.99 (0.41–2.40) 1.89 (0.68–5.26) 0.52 (0.10–2.62) 1.31 (0.54–3.16) 0.94 (0.40–2.21)
G allele 1 (Reference)
T allele 1.13 (0.73–1.76) 1.20 (0.76–1.87) 1.28 (0.73–2.21) 1.22 (0.61–2.45) 1.03 (0.82–2.06) 1.27 (0.82–1.97)

Baseline characteristics of the patients with T2DM

Characteristics (n = 166)
Age (years) 54.0 ± 9.7
Sex (female) 117 (70.5)
Systolic blood pressure (mmHg) 130.4 ± 18.7
Diastolic blood pressure (mmHg) 81.1 ± 8.7
BMI (kg/m2) 25.0 ± 4.0
Waist circumference (cm) 87.6 ± 9.2
FPG (mg/dL) 189.0 ± 71.2
HbA1c (%) 9.61 ± 2.32
CrSr (mg/dL) 0.89 ± 0.80
eGFR (mL/min/1.73 m2) 91.6 ± 26.7

Association between PRKAA2 genetic variation and clinical characteristics of patients with T2DM

Genotype OR (95%CI)

FPG HbA1c CrSr eGFR Blood pressure Obesity status
rs2796498
GG 1 (Reference)
AG 1.24 (0.66–2.34) 0.90 (0.48–1.71) 1.74 (0.86–3.51) 2.51 (0.96–6.54) 0.98 (0.51–1.92) 1.18 (0.63–2.23)
AA 0.99 (0.21–4.69) 0.46 (0.09–2.51) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 1.41 (0.30–6.68) 1.48 (0.31–6.98)
Dominant (GG vs. AG+AA) 1.21 (0.65–1.26) 0.85 (0.46–1.58) 1.49 (0.75–2.98) 2.21 (0.85–5.74) 1.02 (0.54–1.95) 1.21 (0.65–2.24)
Recessive (GG+AG vs. AA) 0.91 (0.20–4.18) 0.48 (0.09–2.57) <0.01 (<0.01–NA) <0.01 (<0.00–NA) 1.42 (0.31–6.56) 1.39 (0.30–6.39)
G allele 1 (Reference)
A allele 1.13 (0.68–1.87) 0.83 (0.50–1.38) 1.19 (0.64–1.97) 1.47 (0.71–3.04) 1.06 (0.62–1.80) 1.18 (0.71–1.96)

rs9803799
TT 1 (Reference)
GT 1.10 (0.40–2.98) 0.86 (0.31–2.38) 0.82 (0.25–2.67) 1.64 (0.43–6.29) 0.55 (0.17–1.76) 0.90 (0.33–2.46)
GG 1.23 (0.08–19.99) 1.23 (0.08–19.99) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 1.77 (0.11–28.94) 1.01 (0.06–16.51)
Dominant (TT vs. GT+GG) 1.11 (0.42–2.88) 0.89 (0.34–2.35) 0.71 (0.22–2.28) 1.43 (0.38–5.44) 0.63 (0.22–1.86) 0.91 (0.35–2.38)
Recessive (TT+GT vs. GG) 1.22 (0.08–19.78) 1.25 (0.08–20.27) <0.01 (<0.01–NA) <0.01 (<0.01–NA) 1.88 (0.12–30.57) 1.03 (0.06–16.66)
T allele 1 (Reference)
G allele 1.11 (0.46–2.69) 0.93 (0.38–2.27) 0.64 (0.21–1.94) 1.23 (0.35–4.39) 0.73 (0.28–1.94) 0.93 (0.38–2.24)

rs2746342
GG 1 (Reference)
GT 1.43 (0.72–2.84) 1.55 (0.78–3.08) 0.95 (0.43–2.06) 2.48 (0.77–7.97) 1.44 (0.70–2.99) 1.90 (0.95–3.77)
TT 1.18 (0.45–3.07) 1.23 (0.49–3.32) 1.65 (0.60–4.56) 1.11 (0.19–6.49) 1.63 (0.60–4.37) 1.39 (0.53–3.59)
Dominant (GG vs. GT+TT) 1.37 (0.71–2.64) 1.48 (0.77–2.86) 1.09 (0.52–2.27) 2.15 (0.68–6.76) 1.48 (0.74–2.98) 1.77 (0.92–3.40)
Recessive (GG+GT vs. TT) 0.95 (0.40–2.23) 0.97 (0.41–2.29) 1.70 (0.70–4.20) 0.59 (0.13–6.16) 1.29 (0.54–3.09) 1.94 (0.40–2.19)
G allele 1 (Reference)
T allele 1.14 (0.73–1.76) 1.19 (0.76–1.84) 1.21 (0.74–1.97) 1.21 (0.62–2.35) 1.28 (0.81–2.02) 1.27 (0.82–1.97)

Context sequence (VIC/FAM) rs2796498, rs9803799, and rs2746342

SNP ID* Context sequence (VIC/FAM dye)
rs2796498 CTGTAACAGTGTTAGTGATTTAAAC[A/G]GAGAGAGCAACCTTACCCTTTCAGT
rs9803799 TAAATACAGGGTTTATATCCCCACA[G/T]TCAATGTAAATTCCTTTTTTTAAAA
rs2746342 AGAGAGGCTAAGATGCAGGCTGTAC[G/T]CTGGGTAGCCATGTACTCAGTTGTA