Morphological and molecular characterization of two species of Neothada Khan, 1973 (Nematoda: Tylenchidae) from Iran, with notes on N. cancellata
Published Online: Feb 02, 2021
Page range: 1 - 10
DOI: https://doi.org/10.21307/jofnem-2020-131
Keywords
© 2021 Manouchehr Hosseinvand et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.
Khan (1973) proposed the genus
Soil samples were collected from the rhizosphere of mosses,
Nematode DNA was extracted from single individuals and DNA extracts were stored at −20°C until use as PCR template. Protocols for DNA extraction were followed as described by Tanha Maafi et al. (2003). Fragments of D2-D3 expansion segments of 28 S rDNA were amplified using the forward D2A (5’–ACAAGTACCGTGAGGGAAAGT–3’) and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3’) primers (Nunn, 1992). The 30 μl PCR contained 15 μl Taq DNA Polymerase 2 × MasterMix (Ampliqon, Denmark), 1 μl (10 pmol μl−1) each of forward and reverse primers, 2 μl of DNA template and 11 μl deionised water. This mixture was placed into a Hybaid Express thermal cycler (Hybaid, Ashford, Middlesex, UK). The thermal cycling profile was denaturation at 95°C for 4 minutes, then 33 cycles of denaturation at 94°C for 30 seconds, annealing at 57°C for 30 seconds, and extension at 72°C for 90 seconds. A final extension was performed at 72°C for 10 minutes. The quality of PCR was checked by electrophoresis of 4 μl of the PCR reaction in 1% agarose gel containing ethidium bromide. Products were visualized and photographed under UV light. The length and concentration of each PCR product was measured by comparison with a low DNA mass ladder (Invitrogen, Carlsbad, CA). The PCR product was purified and sequenced directly for both strands using the same primers with an ABI 3730XL sequencer (Bioneer, Seoul, South Korea). The newly obtained sequences were submitted to GenBank database under accession numbers MN970001 and MN970002 for the D2-D3 expansion fragments of 28 S sequences.
For phylogenetic relationships, analyses were based on D2-D3 expansion fragment of 28 S rDNA. The newly obtained sequences were edited and aligned with other sequences available in GenBank using the Muscle alignment tool implemented in MEGA7 (Kumar et al., 2016). The ambiguously aligned parts and divergent regions were identified using the online version of Gblocks 0.91b (Castresana, 2000) and were removed from the alignments with MEGA7. The best-fit model of nucleotide substitution used for the phylogenetic analysis was statistically selected using jModelTest 2.1.10 (Darriba et al., 2012). Phylogenetic tree was generated with a Bayesian inference method using MrBayes 3.2.6 (Huelsenbeck and Ronquist, 2001; Ronquist et al., 2012).
Morphometric data of
| Neothada major | N. hades | N. cancellata | |||||
|---|---|---|---|---|---|---|---|
| Present study | Maqbool and Shahina (1989) | Present study | Heyns and Van den Berg (1996) | Present study | |||
| n | 15 | cv | 15 | 10 | cv | 10 | 8 |
| L | 657±40.6 (600–728) | 6.1 | 640–800 | 586±50.3 (505–674) | 8.5 | 530–620 | 561±32.5 (501–596) |
| L' | 579±37.8 (521–645) | 6.5 | – | 515±48.1 (440–600) | 9.3 | – | 491±30.9 (431–527) |
| Head-Vulva | 461±27.2 (420–508) | 5.9 | – | 414±35.5 (354–467) | 8.5 | – | 396±24.4 (349–424) |
| R Head-Vulva | 142±11.7 (120–160) | 8.2 | 154–156 | 147±8.3 (127–157) | 5.6 | – | 146±9.9 (125–156) |
| R Head-Anus | 174±12.4 (149–194) | 7.1 | – | 175±9.2 (152–185) | 5.2 | – | 173± 11.1 (150–185) |
| Stylet | 10.9±0.3 (10.3–11.7) | 3.3 | 12–14.4 | 10.5±0.2 (10.0–10.8) | 2.1 | 9.0–10.5 | 10.8±0.2 (10.6–11.2) |
| a | 35.9±4.1 (29–44) | 11.4 | 34–39 | 30.3±2.0 (27.0–33.7) | 6.8 | 25–31 | 29.5±1.7 (27–32) |
| b | 5.7±0.4 (5.2–6.5) | 6.9 | 5.9–6.3 | 5.3±0.2 (4.8–5.7) | 5.4 | 5.3–6.4 | 5.2±0.2 (4.7–5.5) |
| c | 8.3±0.3 (7.5–8.7) | 3.7 | 9.0–10.2 | 8.3±0.4 (7.5–9.1) | 5.8 | 8.1–10.3 | 8.0±0.3 (7.5–8.6) |
| c' | 6.4±0.3 (5.6–7.1) | 6.1 | 5.5–6.0 | 6.0±0.3 (5.5–6.5) | 5.8 | 4.6–6.0 | 6.1±0.4 (5.5–6.6) |
| V | 70.2±0.7 (68.8–71.2) | 1.0 | 70–73 | 70.6±1.1 (68.5–72.7) | 1.6 | 70–74 | 70.9 ± 0.6 (70.0–71.8) |
| V' | 79.7±0.9 (78.0–81.1) | 1.1 | – | 80.3±1.3 (77.0–81.9) | 1.6 | – | 80.8±0.5 (80.4–82.4) |
| R | 202±12.5 (175–222) | 6.2 | 215–245 | 204±10.1 (179–216) | 4.9 | 149–160 | 189± 12.3 (175–191) |
| Excretory pore | 97.2±8.7 (75–110) | 9.0 | – | 94.7±5.8 (87–104) | 6.1 | – | 92.5±6.7 (86–100) |
| Pharynx | 114±7.6 (94–127) | 6.7 | 108–133 | 109.5±8.4 (95–119) | 7.7 | – | 107±9.3 (90–110) |
| R Pharynx | 41±3.0 (36–50) | 7.2 | 45–50 | 47±3.1 (43–52) | 6.6 | 30–38 | 45±2.5 (42–50) |
| Annulus width | 3.8±0.7 (3.2–5.6) | 20.0 | 3.2–4.0 | 2.9±0.2 (2.7–3.5) | 8.3 | 4.0–4.6 | 3.0±0.2 (2.6–3.6) |
| Body width | 18.4±1.7 (15.6–21.0) | 9.6 | – | 19.2±0.8 (17.8–21.0) | 4.5 | – | 18.8±0.6 (18–20) |
| Vulva body width | 17.5±1.5 (15–20) | 9.0 | – | 17.9±0.7 (16.5–19.0) | 4.0 | – | 17.5±0.7 (15.5–18.8) |
| Vulva-Anus | 117±11.8 (101–137) | 10.0 | – | 101.6±14.9 (86–138) | 14.7 | 95±7.1 (81–103) | |
| R Vulva-Anus | 32±3.8 (28–42) | 11.8 | 36–40 | 27±1.4 (25–29) | 5.4 | 21–26 | 27±1.5 (25–28) |
| Tail/Vulva-Anus | 0.6±0.1 (0.6–0.7) | 7.7 | – | 0.7±0.1 (0.5–0.7) | 10.1 | – | 0.7±0.1 (0.6–0.7) |
| Anal body width | 12.2±0.9 (10.8–14.0) | 7.3 | – | 11.5±0.5 (10.8–12.3) | 4.7 | – | 11.1±0.5 (10.5–12.0) |
| Tail length | 78.2±3.5 (70–83) | 4.5 | 67–80 | 70.4±2.7 (65–74) | 3.9 | 55–66 | 69±2.4 (65–71) |
Note: All measurements are in μm and in the form: mean ± standard deviation (range).
Figure 1:
Iranian population of
Figure 2:
Iranian population of
Body straight to slightly ventrally curved. Cuticular annules prominent, at neck 1.5–2.2 µm and at mid-body 2.7–3.5 µm in width. Lateral field with four incisures, delimiting three ridges, starting from middle of procorpus and continue to five or seven annules anterior to tail tip. In addition to the lateral lines, 14 evenly spaced longitudinal incisures around the circumference of the body. Lateral field 6.0–8.5 µm wide occupying 32–42% of the corresponding body diameter, its ridges more pronounced and larger than other longitudinal incisures; annulation and longitudinal incisures produce rectangular tessellation. Cephalic region flatly rounded, with two annules, 7.2–7.5 µm wide at base and 2.5–3.0 µm high. Amphidial aperture a conspicuous longitudinal to slightly bent slit extending as far as the second neck annule. Cephalic framework inconspicuous, weakly sclerotized. Stylet delicate, conus length about one-third (3.2–3.9 µm, or 31–36%) of the total stylet length, 7–8 annules from anterior end; knobs conspicuous, rounded, 1.7–2.2 µm wide. Dorsal pharyngeal gland opening 2.6–4.0 µm from stylet base. Corpus cylindroid with slightly swollen median bulb lacking valve; isthmus as wide as procorpus, nerve ring at mid-isthmus and located 56–73 µm from anterior end. Pharyngeal basal bulb short, pyriform, 7.5–9.0 µm wide, 19–24 µm in length. Pharyngo-intestinal valve hemispherical. Excretory pore slightly sclerotized, at middle of basal bulb, 38–45 annules from anterior end. Hemizonid one annule anterior to the excretory pore, 85–104 µm from anterior end. Deirids adjacent to the level of excretory pore, 87–107 µm from anterior end. Vulva a transverse slit, not protruding, without lateral flaps. Vagina width 6.7–8.0 µm, 37–46% of vulva body diameter. Post-vulval uterine sac length 9.0–12.8 µm or 57–63% of vulval body diameter. Spermatheca long, variable in shape, near-rectangular, 7.5– to 9.0 µm × 26 to 33 µm. Ovary outstretched, oocytes arranged in a single row. Rectum curved to slightly sigmoid, length half of anal body diameter. Tail elongate-conoid, tail tip finely to bluntly rounded, 27–33 annules on ventral side of the tail.
Not found.
In all, 10 females are deposited in the nematode collection of the Department of Plant Protection, Faculty of Agriculture, University of Zanjan, Zanjan, Iran.
Soil around of mosses in Dezful, Khuzestan Province, southwestern Iran, by Manouchehr Hosseinvand at February 2017 (GPS coordinates: 48°47‘18“N, 26°36‘32“E).
Figure 3:
Iranian population of
Figure 4:
Iranian population of
Body straight to slightly ventrally curved in posterior half. Cuticular annules prominent, at neck 1.5–2.2 µm and at mid body 3.2–5.6 µm in width. Lateral field with four incisures, delimiting three ridges, starting at middle of isthmus and continue to seven or nine annules anterior to tail tip. In addition to the lateral lines, 19–20 evenly spaced longitudinal incisures around the circumference of the body. Lateral field 5.5–8.0 µm wide or occupying 30–39% of corresponding body diameter; annulation and longitudinal incisures produce rectangular tessellation. Cephalic region flatly rounded, with one or two annules, 6.8–8.1µm wide at base and 2.5–3.6 µm high. Amphidial aperture a conspicuous longitudinal to slightly bent slit, extending as far as the second neck annule. Cephalic framework inconspicuous, weakly sclerotized. Stylet delicate, conus length about one-third, 3.4–3.9 µm or 32–35% of the total stylet length, without knobs but slightly swellings, 7–8 annules from anterior end. Dorsal pharyngeal gland opening 3.0–4.0 µm from stylet base. Corpus cylindroid, median bulb weakly developed, lacking valve; isthmus slender, slightly narrower than procorpus, nerve ring at posterior part of isthmus and located at 66–86 µm from anterior end. Basal bulb short, pyriform to slightly saccate, 7.7–10.0 µm wide and 18–29 µm in length. Pharyngo-intestinal valve hemispherical. Excretory pore at anterior part of basal bulb, 35–40 annules from anterior end. Hemizonid one to two annules anterior to the excretory pore, 88–104 µm from anterior end. Deirid at level of excretory pore, 92–113 µm from anterior end. Vulva a transverse slit, not protruding, without flaps. Vagina 6.2–9.0 µm or 40–54% of vulva body diameter. Post-vulval uterine sac length 9.0–10.0 µm or 55–74% of vulva body diameter. Spermatheca very long, without specific shape, without sperm. Ovary outstretched, oocytes in single row. Rectum curved to slightly sigmoid, length half of anal body diameter. Tail elongate-conoid, tail tip with narrowly rounded tip, 25–30 annules on ventral side of the tail.
Not found.
In all, 15 females are deposited in the nematode collection of the Department of Plant Protection, Faculty of Agriculture, University of Zanjan, Zanjan, Iran.
Soil around
The morphology and morphometrics of the Iranian population agree well with the type population of
Figure 5:
Iranian population of
Body straight to slightly ventrally curved. Cuticle annules prominent at mid body 2.6–3.6 µm. Lateral field with four incisures, delimiting three ridges, starting at mid of procorpus to five or seven annules anterior to tail tip. In addition to the lateral lines, 14–16 evenly spaced longitudinal incisures around the circumference of the body. Head flatly rounded, with two annules. Amphidial aperture a conspicuous longitudinal to slightly bent slit, extending as far as the second neck annule. Cephalic framework inconspicuous, weakly sclerotized. Stylet delicate, conus length about one-third of the total stylet length. Dorsal pharyngeal gland opening 2.5–4.0 µm from stylet base. Median bulb lacking valve, isthmus as wide as procorpus, nerve ring at mid of isthmus, basal bulb short, pyriform. Excretory pore slightly sclerotized, at mid of basal bulb. Deirids at level of excretory pore. Vulva with transverse slit. Vagina length less than half of vulva body diameter. Post-vulval uterine sac 10–13 µm. Spermatheca long, variable in shape. Ovary outstretched, oocytes in single row. Tail elongate-conoid, tail tip bluntly rounded, 26–33 annules on ventral side of tail.
Not found.
The morphology and morphometrics of the Iranian population agree completely with the data given by Geraert (2008). The present population is different from the other population of Iran (Yaghoubi et al., 2015) in body length (501–596 vs 573–668 µm), number of body annules (175–191 vs 143–160), width of body annules (2.6–3.6 vs
Soil around roots of
Two new D2-D3 28 S rDNA gene sequences were obtained in the present study (MN970001 and MN970002). These sequences showed a 96–97% similarity values to
Figure 6:
Bayesian Inference analysis tree under general time-reversible model of sequence evolution with correction for invariable sites and a gamma-shaped distribution model (GTR + I + G) from known and the newly sequenced
In our 28 S rDNA phylogeny,