Eukaryotic nuclear ribosomal DNA (rDNA) is arranged in tandem repeat arrays in the genome. Each repeat unit consists of one copy of small subunit (SSU) 18S, internal transcribed spacers (ITS1 and ITS2), 5.8S, and large subunit (LSU) 28S rDNA, and is separated by an external transcribed spacer (EST) and an intergenic spacer (IGS) (Hillis and Dixon, 1991). The copy number of the repeats within most eukaryotic genomes is high, which provide large quantities of template DNA for PCR. In
Live J2 from
Agriculturally important nematodes tested in this study.
Taxa | Origin and locality | PCR primer pair | Ta (°C) | Sequencing primers |
---|---|---|---|---|
|
Live specimen 104J12, provided by Dr. Paula Agudelo, Clemson University, Clemson, South Carolina | 18S-CL-F3 and 28S-CL-R | 50 | 530F, 530R, 1912R, 18S-CL-F2, 18S-CL-R2, 18S-CL-R5, ITS-CL-F2,28S-CL-F1, D2AR, 28S-CL-F3, 28S-CL-R1 and 28S-CL-R |
|
Live specimen 104J7, isolated from walnut twig beetles, Washington | 18S-CL-F3 and 28S-CL-R | 57 | 530F, -530R, 18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R7, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, 28S-CL-F1, D2AR, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2 and 1006R |
|
Live specimen 104H46, isolated from Eastern white pine tree, New Hampshire | 18S-CL-F3 and 28S-CL-R | 57 | 530F, -530R, 18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R7, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, 28S-CL-F1, D2A, D2AR, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2 and 1006R |
|
Live specimen 104G38, isolated from the rhizosphere of bamboo, Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 530F, 530R, 1912R, 18S-CL-F2, 18S-CL-R2, 18S-CL-R5, ITS-CL-F2,28S-CL-F1, D2AR, 28S-CL-F3, 28S-CL-R1 and 28S-CL-R |
|
Live specimen 85A5, obtained from French Iris in Wisconsin by USDA-APHIS-PPQ interception | 18S-CL-F3 and 28S-CL-R | 50 | 530R, 1912R,18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R7, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, AR28, V2R, 28S-CL-F1, 28S-CL-F3, D2AR, 28S-CL-R1, and 28S-CL-F2 |
|
Live specimen 85C1, isolated from the rhizosphere of alfalfa, Moab, Utah | 18S-CL-F3 and 28S-CL-R | 50 | 530R, 1912R,18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R7, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, 5.8SF, AB28, V2R, 28S-CL-F1, 28S-CL-F3, 28S-CL-R3, 28S-CL-R1, 28S-CL-F2, 1006R |
|
Live specimen 85G11, isolated from the rhizosphere of alfalfa, St. George, Utah | 18S-CL-F3 and D3B | 50 | 530R, 530F,18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R6, ITS-CL-F2, rDNA15.8S, 5.8SF, V2R, 28S-CL-F1, D2AR, D2A, 28S-CL-R3, 28S-CL-R1, 28S-CL-F2, 1006R |
|
Live specimen 104G36, isolated from the rhizosphere of bamboo, Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 530R, 530F,1912R, 18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-F8, ITS-CL-F2, 5.8SF, V2R, 28S-CL-F1, D2AR, 28S-CL-R1, 28S-CL-F2, 28S-CL-R |
|
Live J2 specimen Hg20, from the isolate, NL1-RHp originally was collected in on the east shore of Maryland and raised on soybean ( |
18S-CL-F3 and D3B | 57 | 530R, 1912R, 18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R7, 18S-Cl-F8, rDNA15.8S, 5.8SF, AB28, 28S-CL-F1, D2A, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2, 1006R, and 28S-CL-R |
|
Live J2 specimen 104F80, isolated from the cyst in the rhizosphere of |
18S-CL-F3 and D3B | 57 | 530R, 530F, 1912R, 18S-CL-R2, ,18S-CL-F2, 18S-CL-R5, ITS-CL-F2, 28S-CL-F1, D2AR, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2, 28S-CL-R |
|
Live specimen 104G35, isolated from the rhizosphere of bamboo, Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 530R, 530F, 1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-R5, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, 5.8SF, AB28, V2R, 28S-CL-F1, D2A, 28S-CL-F3, 28S-CL-R3, 28S-CL-R1, and 28S-CL-F2 |
|
Live specimen 104H88, isolated from the leaf of beech, Perry, Ohio | 18S-CL-F3 and 28S-CL-R | 50 | 530R, 530F, 1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-R5, 18S-CL-R7, ITS-CL-F2, rDNA15.8S, V2R, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2, 1006R and 28S-CL-R |
|
Live J2 specimen Me47 from the isolate, RKN Race 1, originally was collected in Maryland and maintained with ‘PA-136’ pepper in greenhouse pots | 18S-CL-F3 and D3B | 57 | 530R, 530F, 1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R7, ITS-CL-F2, 5.8SF, V2R, 28S-CL-R1, 28S-CL-F2 and 1006R |
|
Live specimen Pr1 from a culture maintained with corn root explant; originally collected from soil in Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 18S-CL-F3, 530R, 530F, 1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R7, ITS-CL-F2, rDNA15.8S, 5.8SF, Ab28, V2R, D2Ar, D2A, 28S-CL-F3, 28S-CL-R3, 28S-CL-R1, 28S-CL-F2 and 28S-CL-R |
|
Live specimen 31G1, obtained by USDA – APHIS – PPQ interception from |
18S-CL-F3 and 28S-CL-R | 50 | 530R, 530F,1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R7, ITS-CL-F2, rDNA15.8S, 5.8SF, AB28, V2R, D2AR, 28S-CL-F1, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2 and 1006R |
|
Live specimen 06D2, isolated from soil in Clarksville, Maryland | 18S-CL-F3 and D3B | 50 | 18S-CL-F3,530R, 530F,1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R6, ITS-CL-F2, 5.8S-CL-F1, 5.8S-CL-R1(XitsS3), V2R, D2AR,D2A, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2, and 1006R |
|
Live specimen 104F83, isolated from the rhizosphere of bamboo, Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 18S-CL-F3, 530R, 530F,1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R6, ITS-CL-F2, 5.8SF, 5.8S-CL-R1(Xist3), V2R, D2AR, 28S-CL-F2, 1006R and 28S-CL-R |
Each PCR reaction was prepared with 2 µl of DNA extract and 23 µl of the PCR master mix [H2O: 16.375 µl; 10x DreamTaqTM (Thermo Fisher Scientific, Waltham, MA, USA) buffer: 2.5 µl; dNTP mix, 2.0 mM each: 2.5 µl; 10 µM forward primer: 0.75 µl; 10 µM reverse primer: 0.75 µl; 0.625U DreamTaqTM Hot Start DNA Polymerase 5 U/µl: 0.125 µl, assembled per manufacturer’s manual] containing the primer pairs 18S-CL-F3 and either D3B or 28S-CL-R (Tables 1 and 2). PCR was carried out within a Bio-Rad MJ Mini or C1000 Touch gradient thermal cycler (Bio-Rad Laboratories, Hercules, CA). The PCR conditions were 95°C for 3 min; 36 cycles of 95°C for 30 sec, annealing temperature (Ta) at 57°C or 50°C (Table 1) for 45 sec, and 72°C for 3 min; and final extension at 72°C for 7 min. PCR products were visualized with the Lonza FlashGelTM DNA system (VWR International, Radnor, PA) and then treated with ExoSAP-IT reagent (Affymetrix, Inc, Santa Clara, CA) according to manufacturers’ protocols. Direct DNA sequencing was performed bidirectionally with multiple primers (Tables 1, 2 and Fig. 1) and an ABI BigDye® Terminator v3.1 kit and in an ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA) owned by the USDA Systematic Entomology Lab, Beltsville, MD. The ribosomal primers, 18S-CL-F7, 18S-CL-R6, 18S-CL-R7, 18S-CL-F8, 5.8S-CL-F1, 5.8S-CL-R1, 28S-CL-F1, 28S-CL-R3, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2 (Table 2) were newly designed with Geneious ver. 10.1.1 (BioMatters, Auckland, New Zealand).
Ribosomal primers used for PCR and sequencing.
Primers | Direction | Loci | Sequence (5′-3′) | PCR | Sequencing | References |
---|---|---|---|---|---|---|
18S-CL-F3 | F | 18S | CTTGTCTCAAAGATTAAGCCATGCAT | ✓ | ✓ | Carta and Li (2018) |
D3B | R | 28S | TCGGAAGGAACCAGCTACTA | ✓ | ✓ | Nunn (1992) |
28S-CL-R | R | 28S | CAGCTACTAGATGGTTCGATTAGTC | ✓ | ✓ | This study |
18S-530F (530F) | F | 18S | AAGTGTGGTGCCAGCAGCCGC | ✓ | Reverse complement of 530R | |
18S-530R (530R) | R | 18S | GCGGCTGCTGGCACCACACTT | ✓ | Thomas et al. (2011) | |
1912R | R | 18S | TTTACGGTCAGAACTAGGG | ✓ | Holterman et al. (2006) | |
18S-CL-R2 | R | 18S | GTTGAGTCAAATTAAGCCGCA | ✓ | Carta and Li (2018) | |
18S-CL-F7 | F | 18S | TGCGGCTTAATTTGACTCAAC | ✓ | This study | |
18S-CL-F2 | F | 18S | CTGTGATGCCCTTAGATGTCC | ✓ | Carta and Li (2018) | |
18S-CL-R5 | R | 18S | GCGGTGTGTACAAAGGGCAGGGAC | ✓ | Carta and Li (2018) | |
18S-CL-R6 | R | 18S | ACCTTGTTACGACTTTTACTTCCTCTA | ✓ | ✓ | This study |
18S-CL-R7 | R | 18S | ACCTTGTTACGACTTTTGCCCGGTTCA | ✓ | ✓ | This study |
18S-CL-F8 | F | 18S | TGAACCGGGCAAAAGTCGTAACAAGGT | ✓ | This study | |
ITS-CL-F2 | F | ITS | ATTACGTCCCTGCCCTTTGTA | ✓ | ✓ | Carta and Li (2018) |
5.8S-CL-F1 | F | 5.8S | GATTCCATCATTCTAAGC | ✓ | This study | |
5.8S-CL-R1 | R | 5.8S | ACCGCTTAGAATGATGGAATC | ✓ | This study | |
rDNA15.8S | F | 5.8S | ACGAGCCGAGTGATCCACCG | ✓ | Cherry et al. (1997) | |
5.8SF | F | 5.8S | CGGTGGATCACTCGGCTCGT | ✓ | Reverse complement of rDNA1.58S | |
AB28 | R | 28S | ATATGCTTAAGTTCAGCGGGT | ✓ | Joyce et al. (1994) | |
28S-CL-F1 | F | 28S | CTGAACTTAAGCATATCAGTAAGC | ✓ | This study | |
VRAIN 2R (V2R) | R | 28S | TTTCACTCGCCGTTACTAAGGGAATC | ✓ | Vrain et al. (1992) | |
D2AR | R | 28S | ACTTTCCCTCACGGTACTTGT | ✓ | Reverse complement of D2A | |
D2A | F | 28S | ACAAGTACCGTGAGGGAAAGT | ✓ | Nunn (1992) | |
28S-CL-R3 | R | 28S | GCAACTTTCCCTCACGGTACTTG | This study | ||
28S-CL-F3 | F | 28S | AAGAGAGAGTTAAAGAGGACGTGAA | ✓ | This study | |
28S-CL-R1 | R | 28S | ACTCCTTGGTCCGTGTTTCAAG | ✓ | This study | |
28S-CL-F2 | F | 28S | CGACCCGTCTTGAAACAC | ✓ | This study | |
28S-1006rev (1006R) | R | 28S | GTTCGATTAGTCTTTCGCCCCT | ✓ | Holterman et al. (2008) |
The forward PCR primer for this long rDNA target was 18S-CL-F3, the reverse primer was D3B and a newly designed 28S primer, 28S-CL-R, was applied as well (Table 2). Figure 2 shows that this long rDNA target was amplified by PCR in six taxa from agriculturally important nematodes. The internal sequencing primers with reading overlaps (Fig. 1) were tested by using cycling amplification. The rDNA sequences resulted from
An approximate base-pair match between primer and template DNA is required for Taq DNA polymerase to begin an efficient PCR amplification cycle (Watson, 1971; Kwok et al., 1994; Wu et al., 2009; Wright et al., 2014). The taxonomic universality of 18S-CL-F3, the forward primer selected for the single primer pair approach, has been presented previously from taxa in Tylenchida and Dorylaimida (Carta and Li, 2018). We have not seen any failures of PCR amplification from the taxa tested with 18S-CL-F3 since it was designed in our lab. The D3B segment primer was selected because it is a universal reverse primer for amplifying the D2D3 segment of 28S across Nematoda (Nunn, 1992). Primer 28S-CL-R was also designed as a substitute for D3B. The primer pair 18S-CL-F3 and either D3B or 28S-CL-R is the primary key to the success of the single primer pair approach achieved in this study. To our knowledge, this is the first report of using a single primer pair to amplify this long rDNA target in diverse agriculturally important nematodes.
Although this long rDNA target was amplified successfully with a traditional Taq DNA polymerase used in the single primer pair approach, it should be noted that Taq DNA polymerase lacks 3′-5′ exonuclease activity and is incapable of proofreading any misincorporated nucleotides during PCR (Tindall and Kunkel, 1988). This inability could make the Taq dissociate from its template DNA before the extension is completed and subsequently limits the size of the amplicon (Arezi et al., 2003). Therefore, it is desirable that thermal proofreading DNA polymerase, Pfu, Vent or others, along with a Taq or a blend of both enzymes be employed in the single primer pair approach when the PCR amplification of the long target becomes difficult (Barnes, 1994; Cheng et al., 1995). Strong non-specific amplicon bands in the specimens 104G35 and Me47 (Lane 3 and Lane 5 in Figure 2, respectively) were observed, however, their sequence reads were not interrupted by the non-target amplicons (data not shown). This is because the ribosomal internal sequencing primers applied in this study can only recognize the rDNA amplicon that has these primer binding sites. Therefore, choosing the internal sequencing primers is critical for the direct DNA sequencing in the single primer pair approach. Primer 530R (Table 2) was selected and 28S-CL-F2 designed specifically to read the 5′-end and 3′-end of this 3.3 to 4.2 kb rDNA amplicon, respectively, during cycling with BigDye® reagents. These two primers were particularly useful for sequencing because the PCR primers may not be used as sequencing primers when non-specific bands (amplicons) occur. Both 18S-CL-R7 and 18S-CL-R6 were designed as sequencing primers initially for Tylenchida and Dorylaimida, respectively. Moreover, they could also be paired with 18S-CL-F3 to amplify the 18S in near-full length as needed; and 28S-CL-R could be paired with ITS-CL-F2 for either the amplification of ITS, or for 28S (D1D2D3) or both to meet different goals.
In this study, we demonstrated the PCR amplification of this 3.3 to 4.2 kb rDNA in 17 agriculturally important nematodes using the single primer pair approach. The taxonomic coverage by these two single primer pairs revealed in this study suggests that they may also be valid for other plant-parasitic nematode taxa in Tylenchida and Dorylaimida. Additionally, this ability was seen in several taxa in Rhabditida with the 18S-CL-F3 and 28S-CL-R pair (data not shown). This study also provides the internal ribosomal sequencing primers that are well positioned in the target rDNA (Table 2 and Fig. 1) with high base coverages to acquire the high quality rDNA sequences spanning from 18S in near full length, ITS1 in full length, 5.8S in full length, ITS2 in full length, to the D1, D2, and D3 segments of 28S at once, which would facilitate deep phylogenetic analysis and accurate taxonomic identification by using individual specimens. Particularly, the D1 segment between ITS2 and 28S and the flanking sequence between 18S and ITS1 were fully revealed by the single primer pair approach, while they are a blind spot in the multiple primer pair approach. These ribosomal primer pairs could also be utilized for meta-barcoding by targeting this long rDNA target from environmental nematode DNA samples. The resulting amplicons could be sequenced using different Next Generation Sequencing platforms such as PacBio (Pacific BioSciences, Menlo Park, CA) and Nanopore (Oxford Nanopore Technologies, Oxford, UK) for long reads.