Expression of LOC285758, a potential long non-coding biomarker, is methylation-dependent and correlates with glioma malignancy grade
, , and
Jan 14, 2017
About this article
Article Category: Research Article
Published Online: Jan 14, 2017
Page range: 331 - 341
Received: Oct 24, 2016
Accepted: Nov 22, 2016
DOI: https://doi.org/10.1515/raon-2017-0004
Keywords
© 2017 Alenka Matjasic, Mara Popovic, Bostjan Matos and Damjan Glavac
This work is licensed under the Creative Commons Attribution 4.0 International License.
Figure 1

Figure 2

Figure 3

Association of LOC285758 expression with patients demographic data and glioma hallmark biomarkers: mutations of IDH1 and TP53, copy number variations of CDKN2A and CDKN2B, and loss of chromosome arm 1p and 19q (1p/19q co-deletion)
LOC285758 promoter methylation | ||||
---|---|---|---|---|
rs | p-value | rs | p-value | |
Gender | -0.044 | 0.634 | 0.009 | 0.920 |
Age at diagnosis (< 45y >) | 0.065 | 0.475 | ||
WHO grade (low/high) | ||||
0.096 | 0.331 | |||
-0.083 | 0.483 | 0.153 | 0.178 | |
1p loss (wt/del) | ||||
19q loss (wt/del) | ||||
1p/19q loss (wt/del) | ||||
0.085 | 0.477 | |||
0.093 | 0.435 |
Patients’ demographics and glioma histopathological classification
Patients demographic | ||
---|---|---|
157 | ||
67/90 (1 : 1.34) | ||
43.8 (SD ±18,89) | ||
86 | ||
71 | ||
15 pilocytic | WHO I | |
9 diffuse | WHO II | |
11 diffuse with signs of anaplasia | WHO II-III | |
9 anaplastic | WHO III | |
23 secondary GBM | WHO IV | |
31 primary GBM | WHO IV | |
4 diffuse | WHO II | |
5 diffuse with signs of anaplasia | WHO II-III | |
28 anaplastic | WHO III | |
2 diffuse | WHO II | |
3 diffuse with signs of anaplasia | WHO II-III | |
17 anaplastic | WHO III |
Primers used for validation of LOC285758 expression profiling results, reference genes and determining methylation status of lncRNA’s promoter
Quantitative real-time PCR | |||
---|---|---|---|
Hs.PT.58.26012748 | 129 | 60 | |
QT00079247 | 95 | 55 | |
CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT | 94 | 60 | |
TTGTTTTTTGAAAGTTTTTTGA | 118 | 55 | |
AAACACAAAAAACCTAACAAAAA |
Top 10 lncRNAs that showed significantly increased/decreased expression in four glioma subtypes, using the LncPath Human Epigenetic Pathway microarray (ArrayStar, USA)
Astrocytoma II+III II+III – tumours of WHO grade II and III; (abs) = absolute value; FC = fold change |
Secondary GBM | Primary GBM | Oligodendroglioma | ||||
---|---|---|---|---|---|---|---|
FC(abs) | Gene Name | FC(abs) | Gene Name | FC(abs) | Gene Name | FC(abs) | Gene Name |
9.775 | 9.840 | 11.343 | 10.085 | ||||
7.863 | 9.105 | 9.761 | 7.233 | ||||
6.203 | 7.971 | 9.402 | 6.241 | ||||
5.247 | 7.578 | 9.267 | 5.454 | ||||
5.211 | 4.509 | 7.012 | 5.360 | ||||
5.107 | 4.243 | 6.720 | 5.043 | ||||
4.374 | 3.657 | 5.527 | 4.991 | ||||
4.211 | 3.394 | 4.851 | 4.930 | ||||
3.861 | 2.878 | 4.770 | 4.351 | ||||
3.795 | 2.695 | 4.525 | 3.846 | ||||
9.638 | 24.555 | 22.494 | 43.328 | ||||
7.026 | 11.341 | 16.532 | 23.879 | ||||
6.797 | 8.050 | 11.157 | 18.840 | ||||
6.148 | 6.845 | 8.208 | 8.073 | ||||
6.003 | 6.623 | 8.207 | 7.092 | ||||
5.820 | 6.470 | 7.979 | 6.887 | ||||
5.052 | 6.243 | 6.325 | 6.318 | ||||
4.216 | 6.114 | 6.218 | 6.205 | ||||
4.082 | 5.799 | 6.066 | 6.090 | ||||
3.887 | 5.712 | 5.652 | 5.873 |