Accesso libero

Establishment of RPA-Cas12a-Based Fluorescence Assay for Rapid Detection of Feline Parvovirus

Ting Wang

Ting Wang

School of Biological and Pharmaceutical Engineering, Shaanxi University of Science and TechnologyXi’an, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Wang, Ting
, 
Hao Zeng

Hao Zeng

School of Biological and Pharmaceutical Engineering, Shaanxi University of Science and TechnologyXi’an, China
Cerca questo autore su
Sciendo|Google Scholar
Zeng, Hao
, 
Qiming Liu

Qiming Liu

School of Biological and Pharmaceutical Engineering, Shaanxi University of Science and TechnologyXi’an, China
Cerca questo autore su
Sciendo|Google Scholar
Liu, Qiming
, 
Weidong Qian

Weidong Qian

School of Biological and Pharmaceutical Engineering, Shaanxi University of Science and TechnologyXi’an, China
Cerca questo autore su
Sciendo|Google Scholar
Qian, Weidong
, 
Yongdong Li

Yongdong Li

Ningbo Municipal Center for Disease Control and PreventionNingbo, China
Cerca questo autore su
Sciendo|Google Scholar
Li, Yongdong
, 
Jian Liu

Jian Liu

Shanghai Animal Disease Prevention and Control CenterShanghai, China
Cerca questo autore su
Sciendo|Google Scholar
Liu, Jian
 e 
Rong Xu

Rong Xu

Ningbo Municipal Center for Disease Control and PreventionNingbo, China
Cerca questo autore su
Sciendo|Google Scholar
Xu, Rong
  
04 mar 2024
Establishment of RPA-Cas12a-Based Fluorescence Assay for Rapid Detection of Feline Parvovirus's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Categoria dell'articolo: ORIGINAL PAPER
Pubblicato online: 04 mar 2024
Pagine: 39 - 48
Ricevuto: 27 set 2023
Accettato: 29 dic 2023
DOI: https://doi.org/10.33073/pjm-2024-005
Parole chiave
© 2024 Ting Wang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
undefined

Fig. 1.

The schematic flow of RPA-Cas12a-based fluorescence assay for the detection of feline parvovirus virus (FPV) by combining recombinase polymerase amplification (RPA) and CRISPR/Cas12a (A). The genomic DNA of FPV was extracted from clinical samples and amplified using RPA to prepare double-stranded DNA (dsDNA) at 37°C. Then, CRISPR/Cas12a was activated by the complex of amplified products of the target gene, Cas12a, and crRNA, and the single-stranded DNA molecules (ssDNA reporter) were cut to produce fluorescence signals. Finally, the readout of the RPA-Cas12a-fluorescence assay was obtained using real-time or end-point fluorescence and naked eyes using the corresponding simple device. Visualization of primers for RPA and crRNA spacer sites to detect Cas12a within the target nonstructural protein 1 (NS1) gene of FPV genome (B). Primers and crRNA are indicated by red and yellow colored text, respectively.
The schematic flow of RPA-Cas12a-based fluorescence assay for the detection of feline parvovirus virus (FPV) by combining recombinase polymerase amplification (RPA) and CRISPR/Cas12a (A). The genomic DNA of FPV was extracted from clinical samples and amplified using RPA to prepare double-stranded DNA (dsDNA) at 37°C. Then, CRISPR/Cas12a was activated by the complex of amplified products of the target gene, Cas12a, and crRNA, and the single-stranded DNA molecules (ssDNA reporter) were cut to produce fluorescence signals. Finally, the readout of the RPA-Cas12a-fluorescence assay was obtained using real-time or end-point fluorescence and naked eyes using the corresponding simple device. Visualization of primers for RPA and crRNA spacer sites to detect Cas12a within the target nonstructural protein 1 (NS1) gene of FPV genome (B). Primers and crRNA are indicated by red and yellow colored text, respectively.

Fig. 2.

Examination of optimal crRNA for RPA-Cas12a-based fluorescence assay for the detection of FPV. The fluorescence readouts of RPA-Cas12a-fluorescence real-time (A) and end-point (B) assay were shown using different crRNA or a combination of crRNA for 30 min at 37°C, respectively. Error bars represent the standard deviation of the data (n = 3). Statistical analysis was applied to evaluate the statistical significance between treated groups and the negative control (NC). **p < 0.05, ***p < 0.001, and n.s. – no significant differences
Examination of optimal crRNA for RPA-Cas12a-based fluorescence assay for the detection of FPV. The fluorescence readouts of RPA-Cas12a-fluorescence real-time (A) and end-point (B) assay were shown using different crRNA or a combination of crRNA for 30 min at 37°C, respectively. Error bars represent the standard deviation of the data (n = 3). Statistical analysis was applied to evaluate the statistical significance between treated groups and the negative control (NC). **p < 0.05, ***p < 0.001, and n.s. – no significant differences

Fig. 3.

Examination of sensitivity of RPA-Cas12a-based fluorescence assay. An increase in the fluorescence intensity with increasing the template concentration of the target gene from 0.1 to 100 copies/μl was observed according to real-time (A) and end-point (B) fluorescence readouts. In addition, the color shift between 1 or higher and 0.1 or lower copies/μl was visualized by the naked eye (C). Error bars represent the standard deviation of the data (n = 3). Statistical analysis was used to assess the difference between treated groups and the corresponding time point of negative control (NC). **p < 0.05, *** p < 0.001, and n.s. – no significant differences
Examination of sensitivity of RPA-Cas12a-based fluorescence assay. An increase in the fluorescence intensity with increasing the template concentration of the target gene from 0.1 to 100 copies/μl was observed according to real-time (A) and end-point (B) fluorescence readouts. In addition, the color shift between 1 or higher and 0.1 or lower copies/μl was visualized by the naked eye (C). Error bars represent the standard deviation of the data (n = 3). Statistical analysis was used to assess the difference between treated groups and the corresponding time point of negative control (NC). **p < 0.05, *** p < 0.001, and n.s. – no significant differences

Fig. 4.

Assessment of specificity of RPA-Cas12a-based fluorescence assay. The specificity of RPA-Cas12a-based fluorescence assay for FPV detection was investigated using genomic DNA extracted from FPV, feline calicivirus/Cat/Shanghai/01/2021 (FCV), feline herpesvirus-1/Cat/Shanghai/01/2014 (FHV-1), feline infectious peritonitis virus VR-990 (FIPV), feline Mycoplasma felis ATCC® 23391™ (MYC), and Chlamydia psittaci ATCC® VR-120™ (CP) as the template. Only FPV produced fluorescence signals according to real-time (A), end-point (B) fluorescence, and the naked eye (C) readouts. Error bars indicate the standard deviations of the data (n = 3). Statistical analysis was used to examine the difference between treated groups and negative control (NC). ***p < 0.001, and n.s. – no significant differences
Assessment of specificity of RPA-Cas12a-based fluorescence assay. The specificity of RPA-Cas12a-based fluorescence assay for FPV detection was investigated using genomic DNA extracted from FPV, feline calicivirus/Cat/Shanghai/01/2021 (FCV), feline herpesvirus-1/Cat/Shanghai/01/2014 (FHV-1), feline infectious peritonitis virus VR-990 (FIPV), feline Mycoplasma felis ATCC® 23391™ (MYC), and Chlamydia psittaci ATCC® VR-120™ (CP) as the template. Only FPV produced fluorescence signals according to real-time (A), end-point (B) fluorescence, and the naked eye (C) readouts. Error bars indicate the standard deviations of the data (n = 3). Statistical analysis was used to examine the difference between treated groups and negative control (NC). ***p < 0.001, and n.s. – no significant differences

Statistical analysis of FPV detection in clinical samples using the RPA-Cas12a-based fluorescence assay and qPCR_ The difference was statistically significant, as determined via the DiagnosticTest using openepi software_

qPCR Positive Negative Total Consistency rate
RPA-Cas12a-based fluorescence Positive 28 0 28 96.67%
Negative  2 30 32
Total 30 30 60

The oligonucleotide sequences for primers and crRNA for the RPA-Cas12a-based fluorescence assay of FPV_

Oligonucleotide name Sequence (5′–3′)
NS1-F1 AATGATGGCACAACCAGGAGGTGAAAATCTT
NS1-R1 ATCCAATTCCATCCGTGCATTCTAAAAATTT
NS1-F2 TTAGAATGCACGGATGGAATTGGATTAAAG
NS1-R2 CCACAGCTTGTGCTATGGCTTGAGCAATAA
NS1-F3 TGATGGCACAACCAGGAGGTGAAAATCTTT
NS1-R3 AATCCAATTCCATCCGTGCATTCTAAAAAT
NS1-F4 TTTAGAATGCACGGATGGAATTGGATTAAAG
NS1-R4 CACAGCTTGTGCTATGGCTTGAGCAATAAT
ssDNA reporter FAM-TTATTATT-BHQ
crRNA1-F GAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATGAATGCACGGATGGAATTGG
crRNA1-R CCAATTCCATCCGTGCATTCATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
crRNA2-F GAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATAATAGACAAGGTGGTAAAAG
crRNA2-R CTTTTACCACCTTGTCTATTATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
crRNA3-F GAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATAATTAATACTTGAAAAAGCA
crRNA3-R TGCTTTTTCAAGTATTAATTATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
crRNA4-F GAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATGACATGTTCTAGAATTTGCA
crRNA4-R TGCAAATTCTAGAACATGTCATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
crRNA5-F GAAATTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGATCAAGATCAAAGTTAGTTAGT
crRNA5-R ACTAACTAACTTTGATCTTGATCTACACTTAGTAGAAATTACTATAGTGAGTCGTATTAATTTC
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Scienze biologiche, Microbiologia e virologia
Feed RSS della rivista