Accesso libero

Molecular analysis of Anaplasma ovis, Theileria ovis and Brucella abortus in adult Ornithodoros lahorensis soft ticks (Acari: Ixodida: Argasidae) isolated from the Xinjiang Uygur Autonomous Region, China

Dandan Liu

Dandan Liu

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Liu, Dandan
, 
Jinming Wang

Jinming Wang

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Wang, Jinming
, 
Yutong Liu

Yutong Liu

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Liu, Yutong
, 
Shuiyi Wang

Shuiyi Wang

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Wang, Shuiyi
, 
Huiru Zhu

Huiru Zhu

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Zhu, Huiru
, 
Bingbing Jiang

Bingbing Jiang

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Jiang, Bingbing
, 
Yongchang Li

Yongchang Li

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Li, Yongchang
, 
Yang Zhang

Yang Zhang

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Zhang, Yang
, 
Bayin Chahan

Bayin Chahan

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Chahan, Bayin
 e 
Wei Zhang

Wei Zhang

College of Veterinary Medicine, Xinjiang Agricultural UniversityÜrümqi, China
Profilo Orcid
Cerca questo autore su
Sciendo|Google Scholar
Zhang, Wei
  
23 set 2024
Molecular analysis of Anaplasma ovis, Theileria ovis and Brucella abortus in adult Ornithodoros lahorensis soft ticks (Acari: Ixodida: Argasidae) isolated from the Xinjiang Uygur Autonomous Region, China's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Pubblicato online: 23 set 2024
Pagine: 355 - 361
Ricevuto: 21 feb 2024
Accettato: 03 set 2024
DOI: https://doi.org/10.2478/jvetres-2024-0049
Parole chiave
© 2024 Dandan Liu et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1.

Map of the Xinjiang Uygur Autonomous Region (XUAR), China. The black dots indicate localities where samples were collected
Map of the Xinjiang Uygur Autonomous Region (XUAR), China. The black dots indicate localities where samples were collected

Fig. 2.

The phylogenetic analysis of Anaplasma ovis identified in this study based on the Msp4 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot
The phylogenetic analysis of Anaplasma ovis identified in this study based on the Msp4 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Fig. 3.

The phylogenetic analysis of Theileria ovis identified in this study based on the 18S rRNA gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot
The phylogenetic analysis of Theileria ovis identified in this study based on the 18S rRNA gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Fig. 4.

The phylogenetic analysis of Brucella abortus identified in this study based on the Omp22 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot
The phylogenetic analysis of Brucella abortus identified in this study based on the Omp22 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Prevalence of pathogens detected in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

Prevalence (%)
Pathogen Shanshan (n = 209) Awat (n = 93) Hejing (n = 24) Yutian (n = 20) Qira (n = 20) Overall (n = 366)
Anaplasma ovis 28.2 (59/209) 23.6 (22/93) 0 (0/24) 40.0 (8/20) 10.0 (2/20) 24.9 (91/366)
Theileria ovis 45.0 (94/209) 35.5 (33/93) 0 (0/24) 0 (0/20) 0 (0/20) 34.7 (127/366)
Brucella abortus 24.4 (51/209) 39.8 (37/93) 25.0 (6/24) 0 (0/20) 0 (0/20) 25.6 (94/366)

Prevalence of single and co-infection with one or more of Anaplasma ovis, Theileria ovis and Brucella abortus in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

Pathogen Number of positive samples/percentage (%)
Single infection Anaplasma ovis 54/366 (14.8)
Theileria ovis 83/366 (22.7)
Brucella abortus 63/366 (17.2)
Co-infection A. ovis + T. ovis 25/366 (6.8)
T. ovis + B. abortus 19/366 (5.2)
A. ovis + B. abortus 12/366 (3.3)
A. ovis + T. ovis + B. abortus 0/366 (0)

PCR amplification of genetic material of pathogens isolated from Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

Pathogen Target gene/region Primer (5′–3′) EPS (base pairs) AT (°C) Reference
Anaplasma ovis Msp4 Forward: CGCCTGCTCCCTACTTGTT 322 58 (13)
Reverse: TTCCACTCTGGCTCCTCCT
Theileria ovis 18S rRNA Forward: TCGAGACCTTCGGGT 520 52 (1)
Reverse: TCCGGACATTGTAAAACAAA
Brucella abortus Omp2 Forward: TGATGGGAGGGACCGACTA 494 55 (24)
Reverse: TGGTTCTTCAGGTTGTTACGC

Collection of Ornithodoros lahorensis soft tick samples in the Xinjiang Uygur Autonomous Region, China

Collection date Collection season Region Number of samples collected Altitude (m), latitude and longitude
Oct. 2020 and Mar. 2021 Autumn and spring Shanshan 209 979; 42°82′ N, 90°25′ E
Mar.–Apr. 2021 Spring Awat 93 1028; 40°76′ N, 80°25′ E
Oct. 2019 Autumn Hejing 24 1100; 42°32′ N, 86°38′ E
Mar. 2022 Spring Yutian 20 1628; 36°41′ N, 81°29′ E
Mar. 2022 Spring Qira 20 1361; 37°3′ N, 80°46′ E
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Scienze biologiche, Biologia molecolare, Microbiologia e virologia, Scienze della vita, altro, Medicina, Medicina veterinaria
Feed RSS della rivista