Molecular analysis of Anaplasma ovis, Theileria ovis and Brucella abortus in adult Ornithodoros lahorensis soft ticks (Acari: Ixodida: Argasidae) isolated from the Xinjiang Uygur Autonomous Region, China
23 set 2024
INFORMAZIONI SU QUESTO ARTICOLO
Pubblicato online: 23 set 2024
Pagine: 355 - 361
Ricevuto: 21 feb 2024
Accettato: 03 set 2024
DOI: https://doi.org/10.2478/jvetres-2024-0049
Parole chiave
© 2024 Dandan Liu et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Prevalence of pathogens detected in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China
Prevalence (%) | ||||||
---|---|---|---|---|---|---|
Pathogen | Shanshan (n = 209) | Awat (n = 93) | Hejing (n = 24) | Yutian (n = 20) | Qira (n = 20) | Overall (n = 366) |
28.2 (59/209) | 23.6 (22/93) | 0 (0/24) | 40.0 (8/20) | 10.0 (2/20) | 24.9 (91/366) | |
45.0 (94/209) | 35.5 (33/93) | 0 (0/24) | 0 (0/20) | 0 (0/20) | 34.7 (127/366) | |
24.4 (51/209) | 39.8 (37/93) | 25.0 (6/24) | 0 (0/20) | 0 (0/20) | 25.6 (94/366) |
Prevalence of single and co-infection with one or more of Anaplasma ovis, Theileria ovis and Brucella abortus in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China
Pathogen | Number of positive samples/percentage (%) | |
---|---|---|
Single infection | 54/366 (14.8) | |
83/366 (22.7) | ||
63/366 (17.2) | ||
Co-infection | 25/366 (6.8) | |
19/366 (5.2) | ||
12/366 (3.3) | ||
0/366 (0) |
PCR amplification of genetic material of pathogens isolated from Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China
Pathogen | Target gene/region | Primer (5′–3′) | EPS (base pairs) | AT (°C) | Reference |
---|---|---|---|---|---|
Forward: CGCCTGCTCCCTACTTGTT | 322 | 58 | ( |
||
Reverse: TTCCACTCTGGCTCCTCCT | |||||
18S rRNA | Forward: TCGAGACCTTCGGGT | 520 | 52 | ( |
|
Reverse: TCCGGACATTGTAAAACAAA | |||||
Forward: TGATGGGAGGGACCGACTA | 494 | 55 | ( |
||
Reverse: TGGTTCTTCAGGTTGTTACGC |
Collection of Ornithodoros lahorensis soft tick samples in the Xinjiang Uygur Autonomous Region, China
Collection date | Collection season | Region | Number of samples collected | Altitude (m), latitude and longitude |
---|---|---|---|---|
Oct. 2020 and Mar. 2021 | Autumn and spring | Shanshan | 209 | 979; 42°82′ N, 90°25′ E |
Mar.–Apr. 2021 | Spring | Awat | 93 | 1028; 40°76′ N, 80°25′ E |
Oct. 2019 | Autumn | Hejing | 24 | 1100; 42°32′ N, 86°38′ E |
Mar. 2022 | Spring | Yutian | 20 | 1628; 36°41′ N, 81°29′ E |
Mar. 2022 | Spring | Qira | 20 | 1361; 37°3′ N, 80°46′ E |