Antimicrobial resistance of Enterococcus species isolated from wild mammals in Aragón, Spain
, , , e
22 apr 2022
INFORMAZIONI SU QUESTO ARTICOLO
Pubblicato online: 22 apr 2022
Pagine: 151 - 159
Ricevuto: 15 dic 2021
Accettato: 04 apr 2022
DOI: https://doi.org/10.2478/jvetres-2022-0020
Parole chiave
© 2022 L.A. García et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Species of wild mammals included in the study classified by origin, main diet and scavenging habit together with number of Enterococcus spp isolated
Mammal order | Species | Scientific name | Origin | Main diet | Scavenging habit** | Individuals (n) | Isolates (n) |
---|---|---|---|---|---|---|---|
Artiodactyla | Iberian ibex | CWFR-LA | Herbivorous | No | 1 | 0 | |
Mouflon | Hunting | Herbivorous | No | 4 | 4 | ||
Red deer | Hunting | Herbivorous | No | 9 | 10 | ||
Roe deer | CWFR-LA | Herbivorous | No | 1 | 2 | ||
Wild boar | Hunting | Omnivorous | No | 17 | 16 | ||
Total | 32 | 32 | |||||
Carnivora | American mink | CWFR-LA | Carnivorous | Yes | 6 | 11 | |
Badger | CWFR-LA | Omnivorous | Yes | 3 | 6 | ||
Beech marten | CWFR-LA | Carnivorous | Yes | 2 | 4 | ||
Common genet | CWFR-LA | Carnivorous | Yes | 1 | 2 | ||
Common otter* | CWFR-LA | Piscivorous | Yes | 3 | 8 | ||
Red fox | CWFR-LA | Carnivorous | Yes | 3 | 3 | ||
Weasel | CWFR-LA | Carnivorous | Yes | 1 | 0 | ||
Total | 19 | 34 | |||||
Chiroptera | European bat free-tailed | CWFR-LA | Insectivorous | No | 1 | 2 | |
Total | 1 | 2 | |||||
Erinaceomorpha | Hedgehog | CWFR-LA | Insectivorous | No | 11 | 24 | |
Total | 11 | 24 | |||||
Lagomorpha | Wild rabbit | Hunting | Herbivorous | No | 38 | 33 | |
Granada hare | Hunting | Herbivorous | No | 2 | 1 | ||
Total | 40 | 34 | |||||
TOTAL | 16 | 103 | 126 |
Antibiotic resistance of Enterococcus spp_ isolates in relation to sample source and order
Factor | Antibiotic | Factor category (n) | Antibiotic resistance n (%) | P value* |
---|---|---|---|---|
Source of samples | ERI | CWFR-LA (61) | 21 (34.43) | 0.0149 |
Hunting (64) | 11 (17.19) | |||
S | CWFR-LA (61) | 18 (29.51) | 0.0024 | |
Hunting (64) | 6 (9.38) | |||
TE | CWFR-LA (61) | 34 (55.74) | 0.0000 | |
Hunting (64) | 7 (10.94) | |||
Order | CIP | Artiodactyla ( |
9 (28.13) | 0.0018 |
Carnivora ( |
24 (72.73) | |||
Erinaceomorpha ( |
9 (37.50) | |||
Lagomorpha ( |
22 (64.71) | |||
Chiroptera ( |
1 (50.00) | |||
TE | Artiodactyla ( |
5 (15.63) | 0.0000 | |
Carnivora ( |
22 (66.67) | |||
Erinaceomorpha ( |
10 (41.67) | |||
Lagomorpha ( |
4 (11.76) | |||
Chiroptera ( |
0 | Not applicable |
Frequency of Enterococcus spp_ isolated from wild mammals in this study and their resistance to quinupristin-dalfopristin
Isolates (n) | Isolates (%) | Resistance to QD n (%) | ||
---|---|---|---|---|
47 | 37.60 | 38 (80.85) | ||
26 | 20.63 | 8 (30.77) | ||
22 | 17.46 | 12 (54.55) | ||
13 (−1) | 9.60 | 9 (75.00) | ||
9 | 7.14 | 5 (55.56) | ||
8 | 6.35 | 6 (75.00) | ||
1 | 0.79 | 1 (100.00) | ||
TOTAL | 125* | 100 | 79 (63.20) | |
Species Order | Isolates (n) | Isolates (%) | Resistance to QD n (%) | P value for associations |
Artiodactyla | 32 | 25.60 | 11 (34.38) | Lag. |
Carnivora | 33 | 26.40 | 20 (60.61) | Carn. |
Chiroptera | 2 | 1.6 | 2 (100.00) | |
Erinaceomorpha | 24 | 19.2 | 16 (66.67) | Erin. |
Lagomorpha | 34 | 27.2 | 30 (88.24) | |
Age | P value for associations | |||
Adult | 70 | 56.00 | 37 (52.86) | Young |
Young | 50 | 40.00 | 38 (76.00) | |
Infant | 5 | 4.00 | 4 (80.0) | Not applicable |
TOTAL | 125* | 100 | 79 (63.20) |
Results of the statistical analysis of E_ faecalis and E_ faecium isolation related to source of sampling, mammal age and sex, main diet and scavenging habit in the studied mammals
Factor | Variable (n) | P value* | ||
---|---|---|---|---|
Source of sampling | CWFR-LA (36) | 19 (52.78) | 17 (47.22) | |
Hunting ( |
28 (84.85) | 5 (15.15) | 0.0025 | |
Age | Adult ( |
15 (46.88) | 17 (53.13) | 0.0009 |
Young ( |
27 (84.38) | 5 (15.63) | ||
Infant ( |
5 (100.00) | 0 | Not applicable | |
Sex** | Female ( |
25 (86.21) | 4 (13.79) | F 0.0078 |
Male (39) | 22 (56.41 | 17 (43.59) | ||
Main diet | Carnivorous ( |
8 (53.33) | 7 (46.67) | 0.0152 |
Herbivorous ( |
28 (84.85) | 5 (15.15) | ||
Scavenging habit | No (48) | 36 (75.00) | 12 (25.00) | |
Yes ( |
11 (52.38) | 10 (47.62) | 0.0383 |
Antibiotic resistance of Enterococcus spp_ isolates in relation to sex, main diet and scavenging habit
Factor | Antibiotic | Factor category (n) | Antibiotic resistance n (%) | P value* |
---|---|---|---|---|
CIP | Female (48) | 31 (64.58) | 0.0096 | |
Sex | Male (75) | 32 (42.67) | ||
Female (48) | 8 (16.67) | |||
GEN | Male (75) | 3 (4.00) | F 0.0200 | |
AMP | Carnivorous ( |
5 (25.00) | F 0.0376 | |
Herbivorous (50) | 3 (6.00) | |||
Carnivorous ( |
16 (80.00) | Carn. |
||
Herbivorous (50) | 28 (56.00) | |||
CIP | Insectivorous ( |
10 (38.46) | ||
Main diet | Omnivorous ( |
6 (27.27) | ||
Piscivorous ( |
5 (71.43) | |||
Carnivorous ( |
15 (75.00) | Carn. |
||
TE | Herbivorous (50) | 9 (18.00) | Carn. |
|
Insectivorous ( |
10 (38.46) | Carn. |
||
Omnivorous ( |
4 (18.18) | Ins. |
||
AMP | No (92) | 3 (3.26) | F 0.0104 | |
Yes ( |
6 (18.18) | |||
CL | No (92) | 6 (6.52) | 0.0368 | |
Yes ( |
6 (18.18) | |||
No (92) | 41 (44.57) | |||
Scavenging habit | CIP | Yes ( |
24 (72.73) | 0.0029 |
No (92) | 19 (20.65) | |||
ERI | Yes ( |
13 (39.39) | 0.0215 | |
No (92) | 12 (13.04) | |||
S | Yes ( |
12 (36.36) | 0.0032 | |
TE | No (92) | 19 (20.65) | 0.0000 | |
Yes ( |
22 (66.67) |
Frequency of Enterococcus spp_ isolates resistant to the studied antibiotics by mammal species
Species | Antibiotic tested |
|||||||||
---|---|---|---|---|---|---|---|---|---|---|
AMP | CL | CIP | ERI | GEN | QD | S | TE | |||
American mink | 11 | 8.80 | 3 | 9 | 4 | 2 | 6 | 3 | 8 | |
Badger | 6 | 4.80 | 1 | 3 | 2 | 1 | 4 | 3 | 4 | |
Beech marten | 4 | 3.20 | 2 | 2 | 3 | 2 | 1 | 2 | 3 | |
Common genet | 2 | 1.60 | 2 | 2 | 2 | |||||
Common otter | 7 | 5.60 | 2 | 5 | 4 | 5 | 3 | 3 | ||
European free-tailed bat | 2 | 1.60 | 1 | 1 | 2 | |||||
Granada hare | 1 | 0.80 | 1 | |||||||
Hedgehog | 24 | 19.20 | 2 | 9 | 6 | 2 | 16 | 4 | 10 | |
Mouflon | 4 | 3.20 | 1 | 1 | 1 | |||||
Red deer | 10 | 8.00 | 1 | 4 | 4 | 2 | 3 | |||
Roe deer | 2 | 1.60 | 1 | 1 | 2 | 1 | 2 | 2 | 2 | |
Red fox | 3 | 2.40 | 1 | 2 | 1 | 1 | 2 | 1 | 2 | |
Wild boar | 16 | 12.80 | 3 | 1 | 7 | |||||
Wild rabbit | 33 | 26.40 | 1 | 2 | 22 | 6 | 5 | 29 | 6 | 4 |
TOTAL N |
125 | 100 | 9 | 12 | 65 | 32 | 11 | 79 | 25 | 41 |
100 | 7.20 | 9.60 | 52.00 | 25.60 | 8.80 | 63.20 | 20.00 | 32.80 |
Primers and conditions for detecting vanA and vanB genes by PCR
Primers (5′—>3′) | Amplification | Reference (length of the amplicon) |
---|---|---|
96°C2 min, 1 cycle | ||
94°C30 s | ||
50°C30 s, 35 cycles | Woodford |
|
F: ATGGCAAGTCAGGTGAAGATGG | 72°C1 min | (399 bp) |
R: TCCACCTCGCCAACAACTAACG | 72°C10 min, 1 cycle | |
94°C3 min, 1 cycle | ||
94°C30 s | ||
F: CAAAGCTCCGCAGCTTGCATG | 58°C2 min, 40 cycles | Dahl |
R: TGCATCCAAGCACCCGATATAC | 72°C2 min | (484 bp) |
72°C6 min, 1 cycle |