INFORMAZIONI SU QUESTO ARTICOLO

Cita

Species of wild mammals included in the study classified by origin, main diet and scavenging habit together with number of Enterococcus spp isolated

Mammal order Species Scientific name Origin Main diet Scavenging habit** Individuals (n) Isolates (n)
Artiodactyla Iberian ibex Capra pyrenaica CWFR-LA Herbivorous No 1 0
Mouflon Ovis orientalis Hunting Herbivorous No 4 4
Red deer Cervus elaphus Hunting Herbivorous No 9 10
Roe deer Capreolus capreolus CWFR-LA Herbivorous No 1 2
Wild boar Sus scrofa Hunting Omnivorous No 17 16
Total 32 32

Carnivora American mink Neovison vison CWFR-LA Carnivorous Yes 6 11
Badger Meles meles CWFR-LA Omnivorous Yes 3 6
Beech marten Martes foina CWFR-LA Carnivorous Yes 2 4
Common genet Genetta genetta CWFR-LA Carnivorous Yes 1 2
Common otter* Lutra lutra CWFR-LA Piscivorous Yes 3 8
Red fox Vulpes vulpes CWFR-LA Carnivorous Yes 3 3
Weasel Mustela nivalis CWFR-LA Carnivorous Yes 1 0
Total 19 34

Chiroptera European bat free-tailed Tadarida teniotis CWFR-LA Insectivorous No 1 2
Total 1 2

Erinaceomorpha Hedgehog Erinaceus europaeus CWFR-LA Insectivorous No 11 24
Total 11 24

Lagomorpha Wild rabbit Oryctolagus cuniculus Hunting Herbivorous No 38 33
Granada hare Lepus granatensis Hunting Herbivorous No 2 1
Total 40 34

TOTAL 16 103 126

Antibiotic resistance of Enterococcus spp. isolates in relation to sample source and order

Factor Antibiotic Factor category (n) Antibiotic resistance n (%) P value*
Source of samples ERI CWFR-LA (61) 21 (34.43) 0.0149
Hunting (64) 11 (17.19)

S CWFR-LA (61) 18 (29.51) 0.0024
Hunting (64) 6 (9.38)

TE CWFR-LA (61) 34 (55.74) 0.0000
Hunting (64) 7 (10.94)

Order CIP Artiodactyla (32) 9 (28.13) 0.0018
Carnivora (33) 24 (72.73)
Erinaceomorpha (24) 9 (37.50)
Lagomorpha (34) 22 (64.71)
Chiroptera (2) 1 (50.00)

TE Artiodactyla (32) 5 (15.63) 0.0000
Carnivora (33) 22 (66.67)
Erinaceomorpha (24) 10 (41.67)
Lagomorpha (34) 4 (11.76)
Chiroptera (2) 0 Not applicable

Frequency of Enterococcus spp. isolated from wild mammals in this study and their resistance to quinupristin-dalfopristin

Enterococcus spp. Isolates (n) Isolates (%) Resistance to QD n (%)
Enterococcus faecalis 47 37.60 38 (80.85)
Enterococcus casseliflavus 26 20.63 8 (30.77)
Enterococcus faecium 22 17.46 12 (54.55)
Enterococcus hirae 13 (−1) 9.60 9 (75.00)
Enterococcus gallinarum 9 7.14 5 (55.56)
Enterococcus mundtii 8 6.35 6 (75.00)
Enterococcus avium 1 0.79 1 (100.00)

TOTAL 125* 100 79 (63.20)

Species Order Isolates (n) Isolates (%) Resistance to QD n (%) P value for associations

Artiodactyla 32 25.60 11 (34.38) Lag. vs Art. F 0.0000
Carnivora 33 26.40 20 (60.61) Carn. vs Art. 0.0195
Chiroptera 2 1.6 2 (100.00)
Erinaceomorpha 24 19.2 16 (66.67) Erin. vs Art. 0.0100
Lagomorpha 34 27.2 30 (88.24)

Age P value for associations

Adult 70 56.00 37 (52.86) Young vs Adult 0.0052
Young 50 40.00 38 (76.00)
Infant 5 4.00 4 (80.0) Not applicable

TOTAL 125* 100 79 (63.20)

Results of the statistical analysis of E. faecalis and E. faecium isolation related to source of sampling, mammal age and sex, main diet and scavenging habit in the studied mammals

Factor Variable (n) E. faecalis n (%) E. faecium n (%) P value*
Source of sampling CWFR-LA (36) 19 (52.78) 17 (47.22)
Hunting (33) 28 (84.85) 5 (15.15) 0.0025

Age Adult (32) 15 (46.88) 17 (53.13) 0.0009
Young (32) 27 (84.38) 5 (15.63)
Infant (5) 5 (100.00) 0 Not applicable

Sex** Female (29) 25 (86.21) 4 (13.79) F 0.0078
Male (39) 22 (56.41 17 (43.59)

Main diet Carnivorous (15) 8 (53.33) 7 (46.67) 0.0152
Herbivorous (33) 28 (84.85) 5 (15.15)

Scavenging habit No (48) 36 (75.00) 12 (25.00)
Yes (21) 11 (52.38) 10 (47.62) 0.0383

Antibiotic resistance of Enterococcus spp. isolates in relation to sex, main diet and scavenging habit

Factor Antibiotic Factor category (n) Antibiotic resistance n (%) P value*
CIP Female (48) 31 (64.58) 0.0096
Sex Male (75) 32 (42.67)

Female (48) 8 (16.67)
GEN Male (75) 3 (4.00) F 0.0200

AMP Carnivorous (20) 5 (25.00) F 0.0376
Herbivorous (50) 3 (6.00)

Carnivorous (20) 16 (80.00) Carn. vs Omn: F 0.0008
Herbivorous (50) 28 (56.00)
CIP Insectivorous (26) 10 (38.46)
Main diet Omnivorous (22) 6 (27.27)
Piscivorous (7) 5 (71.43)

Carnivorous (20) 15 (75.00) Carn. vs Herb. 0.0000
TE Herbivorous (50) 9 (18.00) Carn. vs Ins. 0.0084
Insectivorous (26) 10 (38.46) Carn. vs Omn. F 0.0003
Omnivorous (22) 4 (18.18) Ins. vs Herb. 0.0313

AMP No (92) 3 (3.26) F 0.0104
Yes (33) 6 (18.18)

CL No (92) 6 (6.52) 0.0368
Yes (33) 6 (18.18)

No (92) 41 (44.57)
Scavenging habit CIP Yes (33) 24 (72.73) 0.0029

No (92) 19 (20.65)
ERI Yes (33) 13 (39.39) 0.0215

No (92) 12 (13.04)
S Yes (33) 12 (36.36) 0.0032

TE No (92) 19 (20.65) 0.0000
Yes (33) 22 (66.67)

Frequency of Enterococcus spp. isolates resistant to the studied antibiotics by mammal species

Species Enterococcus spp. isolates (n) Enterococcus spp. (%) Antibiotic tested
AMP CL CIP ERI GEN QD S TE
American mink 11 8.80 3 9 4 2 6 3 8
Badger 6 4.80 1 3 2 1 4 3 4
Beech marten 4 3.20 2 2 3 2 1 2 3
Common genet 2 1.60 2 2 2
Common otter 7 5.60 2 5 4 5 3 3
European free-tailed bat 2 1.60 1 1 2
Granada hare 1 0.80 1
Hedgehog 24 19.20 2 9 6 2 16 4 10
Mouflon 4 3.20 1 1 1
Red deer 10 8.00 1 4 4 2 3
Roe deer 2 1.60 1 1 2 1 2 2 2
Red fox 3 2.40 1 2 1 1 2 1 2
Wild boar 16 12.80 3 1 7
Wild rabbit 33 26.40 1 2 22 6 5 29 6 4

TOTAL          N% 125 100 9 12 65 32 11 79 25 41
100 7.20 9.60 52.00 25.60 8.80 63.20 20.00 32.80

Primers and conditions for detecting vanA and vanB genes by PCR

Primers (5′—>3′) Amplification Reference (length of the amplicon)
96°C2 min, 1 cycle
94°C30 s
vanA 50°C30 s, 35 cycles Woodford et al. (32)
F: ATGGCAAGTCAGGTGAAGATGG 72°C1 min (399 bp)
R: TCCACCTCGCCAACAACTAACG 72°C10 min, 1 cycle
94°C3 min, 1 cycle
vanB 94°C30 s
F: CAAAGCTCCGCAGCTTGCATG 58°C2 min, 40 cycles Dahl et al. (10)
R: TGCATCCAAGCACCCGATATAC 72°C2 min (484 bp)
72°C6 min, 1 cycle
eISSN:
2450-8608
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine