A pilot study to establish an ovalbumin-induced atopic dermatitis minipig model
Pubblicato online: 19 ago 2021
Pagine: 307 - 313
Ricevuto: 18 feb 2021
Accettato: 02 ago 2021
DOI: https://doi.org/10.2478/jvetres-2021-0045
Parole chiave
© 2021 Y.K. Kim et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Skin is a physical barrier preventing water loss and protecting against penetration by external organisms (9). Atopic dermatitis (AD) is an inflammatory skin disorder that presents with pruritus, erythema, swelling, dryness, and fissures. It affects approximately 20% of all people at least once in their lifetime, more commonly in childhood (24, 33). A defect of epidermal integrity due to AD facilitates allergen or hapten entry into the skin and triggers an immune response (20). As AD has complex aetiology involving immune system disorders and/or overactivity, the treatment approach is mainly focused on symptom relief. Recently, a monoclonal antibody against a specific target protein has emerged as another therapeutic option along with the use of conventional drugs (7). Single treatment with lokivetmab, the anti-interleukin 31 (IL-31) antibody is an effective treatment to attenuate pruritus in dogs (30, 32, 39, 41, 42, 43). Precise methods to test the safety and efficacy of new drugs are essential and among them animal models play a significant role in developing novel diagnostic tools and drugs. They are also useful in understanding disease pathogenesis and in the specific case of AD an animal model has both utilities.
The Nc/Nga mouse has been identified as a spontaneous AD animal model (27), which have established by several researchers.
Epicutaneous sensitisation with allergens (20, 40) or haptens (26, 28) has been widely used to establish an AD or allergic contact dermatitis (ACD) model. House dust mites and allergens such as ovalbumin evoke a Th2-dominated response (15, 16). However, haptens such as oxazolone, 2,4-dinitrofluorobenzene (DNFB), or 2,4,6‐trinitrochlorobenzene (TNCB), mediates the Th1 response (28). Another AD animal model can be established through overexpression of cytokine genes
Porcine skin is composed of an epidermis, dermis, and tightly connected subcutaneous layer. The thickness of the epidermis is 30–140 μm in pigs, while it is 50–120 μm in humans (13, 25). In addition, the thickness ratio of epidermis-dermis is approximately 1:10 to 1:13 in pigs, which is similar to that in humans (29). Moreover, the blood vessel and nerve distribution in the dermis are comparable with those in humans (45). These numerous similarities make the porcine a superior model for studies of skin wound healing (2, 17), burns (1), transdermal drug delivery (3, 11), and ACD (44). Thus, we selected the Yucatan minipig to establish the required AD animal model. In this study, we compared the known DNFB-induced AD with a novel ovalbumin-induced AD minipig model. Gross observation, histopathology, and cytokine analysis indicated that ovalbumin is more reliable AD model.
Primers used for quantitative real-time PCR
Gene symbol | Primer sequences (from 5ʹ to 3ʹ) | Length | GenBank accession number |
---|---|---|---|
F: GTCTGCTTACTGGCATGTACCA | 118 | NM214123.1 | |
R: GCTCCATGCACGAGTTCTTTCT | |||
F: CGATCCTAAAGGACTATTTTAATGCAA | 102 | NM213948.1 | |
R: TTTTGTCACTCTCCTCTTTCCAAT | |||
F: GGATGATTTTTCGCCACGGG | 78 | NM213803.1 | |
R: ATGGTAAAGGGCTGCCTCTG | |||
F: ACAGACAGCCGTGTGTTCC | 60 | NM001206359.1 | |
R: ACCTTCACCATCGTGTCTCA |
Fig. 1
Macroscopic and microscopic analysis of 1-fluoro-2,4-dinitrobenzene-induced ACD after 24h sensitisation with a 10% solution and 2h challenge with a 1% solution, shown in images which best represent the changes, selected from images of four skin tissue samples from one minipig
A – Macroscopic images of day-17 skin samples; B – Histopathological image with Masson’s trichrome staining. Spongiosis is marked with a yellow arrowhead; acanthosis is marked with a black arrowhead; perivascular immune cell infiltration at the epidermis–dermis junction is marked with a blue arrowhead; C – Immunohistochemistry. CD4+ lymphocytes, major basic protein (MBP)+ eosinophils, and CD11b+ macrophages are marked by black arrow heads. Scale bar = 100 μm

After the shorter, 30 min sensitisation, the outer layer of the skin was found to be swollen and red and a crust had formed over it (days 3–10). However, the severity was less than that exhibited by the minipigs which had been sensitised for 24 h (Fig. 1A). From the challenge, scabbing remained constant with no phenotypic difference from day 15 to day 17 (Fig. 2A). In Masson’s trichrome staining, an increase in the epidermis thickness (acanthosis) when compared with that of the untreated skin, spongiosis of the epidermis, and moderate immune cell infiltration in the dermis were observed (Fig. 2B and 2C). In immunohistochemistry, the counts of CD4+ lymphocytes and MBP+ eosinophils were massively increased, while CD11b+ macrophages were not detected (Fig. 2D–2F). These data suggest that 30 min treatment with 10% DNFB inflicts more similar AD to the human variety than 24 h treatment in terms of gross observation and histological findings. However, it may not be a suitable AD model due to skin layer damage. Another ligand was applied to develop an AD minipig model without this problematic aspect.
Fig. 2
Macroscopic and microscopic analysis of modified 1-fluoro-2,4-dinitrobenzene-induced ACD after 30 min sensitisation with a 10% solution and 2h challenge with a 1% solution shown in images which best represent the changes, selected from images of eight skin tissue samples from two minipigs
A – Macroscopic images of day-3, day-8, day-10, day-15, and day-17 skin samples; B – Histopathological image with Masson’s trichrome staining. Scale bar = 20 μm; C – Thickness of epidermis. p* < 0.05; D –F – Immunohistochemistry. D – CD4+ lymphocytes; E – major basic protein (MBP) + eosinophils; F – CD11b+ macrophages. All named cells are marked by black arrowheads. Margins of scab, epidermis, and dermis are marked with dotted lines. Scale bar = 100 μm; Ctl – controls; DNFB – 1-fluoro-2,4-dinitrobenzene; UL – upper left; UR – upper right; LL – lower left; LR – lower right

Fig. 3
Macroscopic and microscopic analysis of ovalbumin-induced AD shown in representative images shown in images which best represent the changes, selected from images of eight skin tissue samples from two minipigs
A – Macroscopic images of day-3, day-8, day-10, day-15, and day-17 skin samples; B – Histopathological image with Masson’s trichrome staining. Scale bar = 20 μm; C – Thickness of epidermis. p* < 0.05; D –F – Immunohistochemistry. D – CD4+ lymphocytes; E – major basic protein (MBP) + eosinophils; F – CD11b+ macrophages. All named cells are marked by black arrowheads. Margins of scab, epidermis, and dermis are marked with dotted lines. Scale bar = 100 μm; Ctl – controls; ova – ovalbumin; UL – upper left; UR – upper right; LL – lower left; LR – lower right

Fig. 4
Analysis of the cytokine mRNA in AD skin as quantified by quantitative reverse transcriptase PCR
A – porcine (

Fig. 5
Analysis of the absolute cytokine protein level in AD skin and serum as quantified by ELISA
A – porcine (

In this study, we developed an AD minipig model by applying DNFB and ovalbumin ligands with 24 h or 30 min treatment times. As AD is diagnosed based on the symptoms of skin inflammation (such as pruritus, erythema, and hyperkeratosis), the potential for similar gross observations in an animal model as in human AD is essential. The minipig is the only experimental animal that has tight subcutaneous connective tissue and similar thickness of the skin layer to humans. Thus, this species were chosen to establish the AD animal model. Sensitisation only with DNFB had been used to develop an AD minipig model prior to this research (44). DNFB triggers the formation of Langerhans or dendritic cells in the dermis when it induces AD, and these cells migrate to the lymph node and then prime naïve T cells. When the skin is re-exposed to DNFB, allergen-specific CD8+ T cell-mediated skin inflammation occurs (10). However, DNFB in a solvent (acetone:DMSO:olive oil mixture) seems to damage the skin severely. Regardless of the DNFB treatment duration being short or long, DNFB-applied skin was affected by physical disruption of the skin barrier (Figs 1A and 2A). Ovalbumin-induced AD involves different pathological mechanisms to the DNFB-induced condition. Ovalbumin-sensitised skin was infiltrated by more CD4+ T cells and eosinophils, and responded in the dominant-Th2 manner producing more IL-4, IL-5, and IL-13 (26, 27). As ovalbumin mainly mediates the Th2 response, we assumed that ovalbumin treatment may induce typical AD. In fact, the skin did not reveal any epithelial defect, but redness and hyperkeratosis were detected after ovalbumin treatment (Fig 3A). Furthermore, DNFB and ovalbumin increased the counts of CD4+ T lymphocytes and MBP+ eosinophils in the dermis (Figs 2D, 2E, 3D and 3E). Ovalbumin-induced AD in mice showed tissue infiltration by CD4+ T lymphocytes and CD11b+ macrophages (18), while eosinophil infiltration was found in DNFB-induced AD in the same experimental model (19). The difference in the infiltrating immune cells might be related to different species (rodent
It is known that DNFB or ovalbumin induce different immune responses (Th1
dominant in the chronic form (5, 34). Moreover, cutaneous ovalbumin sensitisation mediates the combination of Th1, Th2, and Th17 immune responses (35). In fact, we noted that DNFB or ovalbumin upregulate both Th2-related
There is evidence that AD initiates local skin inflammation, elevates cytokines levels and activates T cell, leading to a systemic inflammatory response (40). Airway inflammation (21) as well as cardiovascular and neuropsychiatric disorders (36, 38) accompanied AD. Fig. 5 demonstrates a similar cytokine expression pattern in the serum to that in the skin, indicating the possibility of systemic inflammation under DNFB or ovalbumin treatment. In the present study, the outcomes of induction of AD in minipig models by DNFB and ovalbumin were compared. Both DNFB and ovalbumin mediated epidermal hyperplasia, epidermal oedema formation, and CD4+ T lymphocyte and eosinophil infiltration into the dermis, and upregulated inflammatory cytokine expression. Interestingly, DNFB induced severe skin damage, while ovalbumin showed a similar macroscopic phenotype to that of human AD. Based on these results, we concluded that the ovalbumin-treated AD minipig is the more reliable and representative animal model. To the best of our knowledge, this is the first study utilising ovalbumin to induce AD in a minipig model. We hope that the ovalbumin-induced AD minipig model becomes a valuable tool for development of drugs to treat AD. Proven as it is by histopathological findings for phenotype and immune cell infiltration and molecular findings for cytokines, the ovalbumin-induced AD minipig model is a sufficiently representative model for this purpose in our contention.