Accesso libero

Occurrence of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area in China

Zhang Guowu
Zhang Guowu
, 
Zhang Kai
Zhang Kai
, 
Wang Xifeng
Wang Xifeng
, 
Ji Chunhui
Ji Chunhui
, 
Ning Chengcheng
Ning Chengcheng
, 
Zhao Yue
Zhao Yue
, 
Qiao Jun
Qiao Jun
, 
Meng Qingling
Meng Qingling
, 
Zhang Xingxing
Zhang Xingxing
, 
Cai Kuojun
Cai Kuojun
, 
Zhang Jinsheng
Zhang Jinsheng
, 
Zhang Zaichao
Zhang Zaichao
 e 
Cai Xuepeng
Cai Xuepeng
   | 06 nov 2020
Journal of Veterinary Research's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Pubblicato online: 06 nov 2020
Pagine: 509 - 515
Ricevuto: 21 apr 2020
Accettato: 12 ott 2020
DOI: https://doi.org/10.2478/jvetres-2020-0071
Parole chiave
© 2020 Z. Guowu et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Morphological characteristics of eggs of different parasitic worms in the faeces of camels in the Tianshan Mountains pastoral areaA – Nematodirus spp.; B – Marshallagia spp.; C – Fasciola hepatica; D – Chabertia ovina; E – Bunostomum spp.; F – Moniezia expansa; G – Haemonchus contortus; H – Trichostrongylus spp.; I – Ostertagia spp.; J – Trichuris spp.; K – Strongyloides papillosus; L – Dicrocoelium spp.; M – Eimeria spp.; N – Thysaniezia ovilla; O – Hasstilesia ovis
Morphological characteristics of eggs of different parasitic worms in the faeces of camels in the Tianshan Mountains pastoral areaA – Nematodirus spp.; B – Marshallagia spp.; C – Fasciola hepatica; D – Chabertia ovina; E – Bunostomum spp.; F – Moniezia expansa; G – Haemonchus contortus; H – Trichostrongylus spp.; I – Ostertagia spp.; J – Trichuris spp.; K – Strongyloides papillosus; L – Dicrocoelium spp.; M – Eimeria spp.; N – Thysaniezia ovilla; O – Hasstilesia ovis

Fig. 2

Molecular detection of nematode eggs with similar morphological structure in camel faecesM – DNA maker DL1000 (1000, 700, 500, 400, 300, 200, 100 bp); Lanes 1, 4, 5, 6, and 10 – negative results; Lane 2 – Haemonchus contortus; Lane 3 – Trichostrongylus spp.; Lane 7 – Chabertia ovina; Lane 8 – Ostertagia spp.; Lane 9 – Bunostomum spp.
Molecular detection of nematode eggs with similar morphological structure in camel faecesM – DNA maker DL1000 (1000, 700, 500, 400, 300, 200, 100 bp); Lanes 1, 4, 5, 6, and 10 – negative results; Lane 2 – Haemonchus contortus; Lane 3 – Trichostrongylus spp.; Lane 7 – Chabertia ovina; Lane 8 – Ostertagia spp.; Lane 9 – Bunostomum spp.

Fig. 3

Mixed infection with different species of gastrointestinal parasite in camels in the Tianshan Mountains pastoral area
Mixed infection with different species of gastrointestinal parasite in camels in the Tianshan Mountains pastoral area

Prevalence of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area

Potential propensity factorNumber of examined camelsMean number of parasite species in co-infectionMean EPG
Young camels (>2 years)1066 ± 1.6a1046 ± 87.2a
AgeSub-adult camels (2–6 years)1397 ± 1.8a779 ± 39.6a
Adult camels (>6 years)11711 ± 1.5b462 ± 40.7b
SexMale Female206 1569 ± 1.2a 10 ± 1.9a901 ± 85.5a 1027 ± 101.2a

Primers used in the study

PrimerNucleotide sequence (5′ to 3′)Target geneSize of amplified product (bp)
FP1AGGTATCTGTAGGTGAACCTGCRibosomal ITS1 of Haemonchus contortus810
RP1ATACAAATGATAAAAGAACATC
FP2GAGAGGACTGCGGACTGCTGTARibosomal ITS1 of Trichostrongylus spp.240
RP2CTCACACACAGAGCTCTAACGG
FR3CTGCGGAAGGATCATTGTCGAARibosomal ITS1 of Chabertia ovina475
RP3ACTCTAAGCGTCTGCAATTCGT
FR4TGTACACACCGCCCGTCGCTGTRibosomal ITS1 of Ostertagia spp.475
RP4TGACAACCAGGTACCGTACACA
FR5GGACTGCGGACTGCTGTATCGARibosomal ITS1 of Bunostomum spp.475
RP5TGTTAAACGTAAAAAATTGGTT

Summary statistics of gastrointestinal parasites in camels in the Tianshan Mountains pastoral area

Parasite speciesInfection rate (%)Mean EPGLength of egg (μm)Width of egg (μm)
Ostertagia spp.100 (362/362)298 ± 57.171.25 ± 9.1236.44 ± 4.57
Trichostrongylus spp.98.1 (355/362)105 ± 36.282.24 ± 10.8339.63 ± 3.53
Haemonchus contortus88.1 (319/362)176 ± 62.575.65 ± 5.7846.35 ± 7.88
Nematodirus spp.87.3 (316/362)138 ± 41.8241.36 ± 23.14111.93 ± 18.51
Marshallagia spp.80.4 (291/362)129 ± 38.7182.89 ± 11.9081.56 ± 7.42
Trichuris spp.77.3 (281/362)93 ± 22.975.42 ± 6.5735.27 ± 3.46
Chabertia ovina18.2 (66/362)71 ± 10.489.24 ± 8.3352.26 ± 5.72
Bunostomum spp.9.9 (36/362)45 ± 14.888.67 ± 7.9148.22 ± 2.35
Strongyloides papillosus33.1 (120/362)113 ± 8.751.78 ± 8.7530.58 ± 5.67
Thysaniezia ovilla60.8 (220/362)126 ± 29.425.18 ± 3.1522.34 ± 2.78
Moniezia expansa42.3 (153/362)103 ± 41.163.13 ± 4.3246.86 ± 5.31
Dicrocoelium spp.62.4 (226/362)82 ± 6.839.19 ± 4.7431.25 ± 3.16
Fasciola hepatica24.6 (89/362)20 ± 13.5140.55 ± 7.6884.54 ± 8.12
Hasstilesia ovis91.7(332/362)56 ± 17.530.12 ± 3.8118.32 ± 1.72
Eimeria spp.73.5 (266/362)94 ± 16.234.18 ± 2.3222.17 ± 1.72
eISSN:
2450-8608
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine
Feed RSS della rivista