Companion birds (n) | Age (months) | Number of samples by bird seller | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
A A to M indicate thirteen different bird sellers | B | C | D | E | F | G | H | I | J | K | L | M | ||
60 | 3 | |||||||||||||
48 | 1 | |||||||||||||
2–12 | 11 | 5 | 5 | 10 | 2 | 7 | 10 | 15 | 10 | 8 | 8 | 7 | 8 | |
24 | 2 | |||||||||||||
36 | 1 | |||||||||||||
Total (113) | 12 | 5 | 5 | 14 | 2 | 9 | 10 | 15 | 10 | 8 | 8 | 7 | 8 |
Primer names | Sequence (5′–3′) | Target region | Size (bp) | References |
---|---|---|---|---|
BFDV-seq-F | TTAACAACCCTACAGACGGCGA | replication associated | ||
BFDV-seq-R | GGCGGAGCATCTCGCAATAAG | protein (rep) gene | 605 | (21) |
APV-Ot-2,105-F | CAGCACAGAGGTACCGTGTT | VP1 gene | 831 | (1) |
APV-Ot-2,846-R | ATCAGAGCCCTGCATGCTTT |
Companion bird | Only APV Positive/total examined (%) | Only BFDV Positive/total examined (%) | APV & BFDV Positive/total examined (%) |
---|---|---|---|
0/3 (0) | 0/3 (0) | 0/3 (0) | |
0/1 (0) | 0/1 (0) | 0/1 (0) | |
40/106 (37.7) | 11/106 (10.4) | 14/106 (13.2) | |
1/2 (50) | 1/2 (50) | 0/2 (0) | |
0/1 (0) | 0/1 (0) | 0/1 (0) | |
Total | 41/113 (36.3) | 12/113 (10.6) | 14/113 (12.4) |